ID: 976765044

View in Genome Browser
Species Human (GRCh38)
Location 4:88591040-88591062
Sequence CCACCCTACTCGGCTAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1335
Summary {0: 1, 1: 0, 2: 29, 3: 237, 4: 1068}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976765039_976765044 8 Left 976765039 4:88591009-88591031 CCTCCTGAGTAGCTGGGACTACA 0: 40849
1: 157871
2: 218647
3: 208196
4: 128589
Right 976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG 0: 1
1: 0
2: 29
3: 237
4: 1068
976765037_976765044 14 Left 976765037 4:88591003-88591025 CCTCAGCCTCCTGAGTAGCTGGG 0: 92886
1: 198857
2: 236674
3: 157910
4: 88870
Right 976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG 0: 1
1: 0
2: 29
3: 237
4: 1068
976765035_976765044 18 Left 976765035 4:88590999-88591021 CCTGCCTCAGCCTCCTGAGTAGC 0: 77881
1: 176222
2: 210480
3: 146546
4: 90715
Right 976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG 0: 1
1: 0
2: 29
3: 237
4: 1068
976765034_976765044 29 Left 976765034 4:88590988-88591010 CCAGTGATTCTCCTGCCTCAGCC 0: 1289
1: 3089
2: 4953
3: 5104
4: 5315
Right 976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG 0: 1
1: 0
2: 29
3: 237
4: 1068
976765041_976765044 5 Left 976765041 4:88591012-88591034 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG 0: 1
1: 0
2: 29
3: 237
4: 1068

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976765044 Original CRISPR CCACCCTACTCGGCTAATTT TGG Intronic
900097720 1:946902-946924 CCACCACACCCAGCTAATTTTGG - Intronic
900197337 1:1383185-1383207 CCACCATGCCTGGCTAATTTTGG - Intergenic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901247350 1:7742999-7743021 CCACCATATCTGGCTAATTTTGG + Intronic
901270377 1:7948516-7948538 CCACCATGCCCAGCTAATTTTGG - Intergenic
901281035 1:8035132-8035154 CCACCATGCTCGGCTGAATTAGG + Intergenic
901612757 1:10512110-10512132 CCCCCACGCTCGGCTAATTTTGG + Intronic
901754015 1:11429948-11429970 CCACTATACCCGGCTAATTTTGG + Intergenic
901805311 1:11735147-11735169 CCACCATGCCCTGCTAATTTTGG + Intergenic
901869439 1:12128985-12129007 CCACCATGCCTGGCTAATTTTGG + Intronic
902036564 1:13462477-13462499 CCACCATACCCAGCTAATTTTGG + Intergenic
902249445 1:15144335-15144357 CCACCCTGCCCGGCTGATTTGGG + Intergenic
902276158 1:15341027-15341049 CCACCACACCTGGCTAATTTTGG - Intronic
902289747 1:15428342-15428364 CCACCATGCCCGGCTAATTTTGG - Intronic
903251375 1:22055639-22055661 CAACCAGACCCGGCTAATTTTGG + Intronic
903272488 1:22198750-22198772 CCACCACGCCCGGCTAATTTTGG + Intergenic
903498131 1:23785338-23785360 CCACCATGCCCGGCAAATTTTGG - Intronic
903509561 1:23864855-23864877 CCACCACGCCCGGCTAATTTTGG + Intronic
903609019 1:24596528-24596550 CCACCATGCCTGGCTAATTTTGG - Intronic
903626997 1:24738023-24738045 CCACCATGCCTGGCTAATTTTGG + Intergenic
903777721 1:25803853-25803875 CCACCATGCCCAGCTAATTTTGG + Intronic
903784851 1:25853442-25853464 CCACCACACCTGGCTAATTTTGG - Intronic
903910654 1:26722396-26722418 CCACCATGCCAGGCTAATTTTGG + Intronic
904057029 1:27677836-27677858 CCACCATGCTTGGCTAATTATGG - Intergenic
904057203 1:27679223-27679245 CCACCATGCTCAGCTAATTATGG + Intergenic
904141497 1:28357183-28357205 CCACCACACCCGGCTAATTTTGG - Intergenic
904147516 1:28405477-28405499 CCACCATGCCCAGCTAATTTTGG + Intronic
904568401 1:31442371-31442393 CCACCATGCCCAGCTAATTTTGG - Intergenic
904668466 1:32143214-32143236 CCACCATGCCCAGCTAATTTTGG + Intronic
904682222 1:32237246-32237268 CCACCATGCCTGGCTAATTTTGG + Intergenic
904742954 1:32692591-32692613 CCACCATGCCCAGCTAATTTGGG - Intronic
904793900 1:33044470-33044492 CCACCACACCTGGCTAATTTTGG - Intronic
905057235 1:35106454-35106476 CCACCATGCCCAGCTAATTTTGG - Intronic
905230577 1:36512666-36512688 CCACCCTGCCTGGCTAATTTGGG - Intergenic
905332868 1:37219223-37219245 CCACCATGCCTGGCTAATTTTGG - Intergenic
905495102 1:38378616-38378638 CCGCCACACTCGGCTAATTTTGG - Intergenic
906475711 1:46168001-46168023 CCACCACACACAGCTAATTTTGG - Intronic
906770313 1:48477402-48477424 CCACCATACCCAGCTAATTTTGG - Intergenic
907034085 1:51200818-51200840 CCACCGCACTCGGCTATGTTTGG + Intergenic
907202328 1:52738329-52738351 ACACCATGCCCGGCTAATTTTGG + Intronic
907214600 1:52851548-52851570 CCACCACACCTGGCTAATTTTGG + Intronic
908151411 1:61306426-61306448 CCACCATGCCTGGCTAATTTTGG + Intronic
908217550 1:61969844-61969866 CCACCACACCTGGCTAATTTTGG + Intronic
908242255 1:62197232-62197254 CCACCATGCCCAGCTAATTTTGG - Intronic
908263869 1:62359978-62360000 CCACCACACCCAGCTAATTTTGG - Intergenic
908383395 1:63617552-63617574 CCACCATGCCCTGCTAATTTTGG - Intronic
908548061 1:65181537-65181559 CCACCATGCCTGGCTAATTTTGG + Intronic
908719137 1:67105171-67105193 CCACCACACCCGGCTTATTTTGG - Intronic
908990551 1:70082935-70082957 CCACCACACCCAGCTAATTTTGG + Intronic
909360176 1:74750409-74750431 CCACCATGCCTGGCTAATTTTGG - Intronic
910896702 1:92077486-92077508 CCACCACACCTGGCTAATTTTGG + Intergenic
910929581 1:92429562-92429584 CCACCACACCCAGCTAATTTTGG + Intergenic
911350319 1:96745911-96745933 CCACCATACCCCGCTAATTATGG - Intronic
911799877 1:102122555-102122577 CCACCATACTCAGCTAATTTTGG - Intergenic
912057740 1:105626644-105626666 CCACCATGCCCAGCTAATTTTGG + Intergenic
912332500 1:108832374-108832396 CCACCCCACCCAGCTAATTTTGG + Intronic
912347759 1:108980574-108980596 CCACCATACCCGGCTAATTTTGG - Intronic
912498248 1:110105240-110105262 CTACCATGCTCTGCTAATTTTGG + Intergenic
912572813 1:110637041-110637063 CCACCATGCCTGGCTAATTTGGG - Intergenic
913006383 1:114636510-114636532 CCACCATGCCTGGCTAATTTTGG - Intronic
913027039 1:114854294-114854316 CCACCACACCCGGCTATTTTAGG + Intergenic
913223120 1:116675301-116675323 CCACCACACCTGGCTAATTTTGG + Intergenic
914215633 1:145625490-145625512 CCACCATACCCGGCTAATTTTGG + Intronic
914467581 1:147945875-147945897 CCACCATACCCGGCTAATTTTGG + Intronic
914753727 1:150551745-150551767 CCACCACACCCAGCTAATTTTGG - Intronic
914875337 1:151509454-151509476 CCACCACACCGGGCTAATTTTGG - Intergenic
915364504 1:155307065-155307087 CCACCATGCTGGGCTAATTTTGG + Intergenic
915491860 1:156254594-156254616 CCACCATGCCTGGCTAATTTTGG + Intronic
915583946 1:156833402-156833424 CCACCATGCCCAGCTAATTTTGG - Intronic
916139990 1:161687975-161687997 CCACCATACCAGGCTAATTTTGG - Intergenic
916311323 1:163401871-163401893 CCACCACACGCAGCTAATTTTGG + Intergenic
916465230 1:165067372-165067394 CCACCACACCCAGCTAATTTTGG + Intergenic
916690485 1:167185519-167185541 CCACCACACCCAGCTAATTTTGG - Intergenic
916803942 1:168240757-168240779 CCACCACGCTCGGTTAATTTTGG - Intronic
917071416 1:171155171-171155193 CCACCACGCCCGGCTAATTTTGG - Intronic
917297181 1:173532757-173532779 CCACCATACTCGGCCTGTTTTGG - Intronic
917400428 1:174642935-174642957 CCACCACTCTGGGCTAATTTTGG + Intronic
917812648 1:178674611-178674633 CCACCATGCCCAGCTAATTTTGG + Intergenic
917822167 1:178774120-178774142 CCACCACACCCAGCTAATTTTGG - Intronic
917845835 1:179019613-179019635 CCACCATGCCCAGCTAATTTTGG + Intergenic
917908206 1:179611201-179611223 CCACCATACTTGGCTAATTTTGG + Intronic
918196701 1:182229130-182229152 CCACCATACCTGGCTAATTTTGG - Intergenic
918333746 1:183486848-183486870 CCACCACACCCAGCTAATTTTGG + Intronic
918334483 1:183494979-183495001 CCACCATGCCCAGCTAATTTTGG + Intronic
918769530 1:188536850-188536872 CCACCATGCCCGGCTAATTTTGG - Intergenic
919204963 1:194410007-194410029 CCACCATGCCCAGCTAATTTTGG + Intergenic
919635273 1:199997724-199997746 CCACCACACTCAGCTAATTTTGG - Intergenic
919687514 1:200498022-200498044 CCACCACACCTGGCTAATTTTGG + Intergenic
919902774 1:202056505-202056527 CCACCATACCTGGCTAATGTTGG + Intergenic
920031705 1:203041437-203041459 CCACCATGCCCAGCTAATTTTGG - Intronic
920154490 1:203937464-203937486 CCACCATGCCCAGCTAATTTTGG - Intergenic
920214483 1:204352219-204352241 CCACCATGCCGGGCTAATTTTGG - Intronic
920410029 1:205751907-205751929 CCACCATGCCCAGCTAATTTTGG + Intergenic
920889173 1:209966022-209966044 CCACCACACCCAGCTAATTTTGG + Intronic
921351308 1:214238715-214238737 CCACCACACCCAGCTAATTTTGG + Intergenic
921450444 1:215299535-215299557 CCACCACACCCGGCTAATTTTGG - Intergenic
921547783 1:216492831-216492853 CCACCACACCCAGCTAATTTTGG + Intergenic
921714668 1:218405654-218405676 CCACCATACCTGGCTCATTTAGG + Intronic
921847979 1:219904345-219904367 CCACCATGCCCAGCTAATTTTGG - Intronic
922125952 1:222723829-222723851 CCACCATACCCAGCTAATTAGGG + Intronic
922645646 1:227283903-227283925 CCACCATGCCCAGCTAATTTGGG - Intronic
923231178 1:231988031-231988053 TCACCACACCCGGCTAATTTTGG - Intronic
923389497 1:233499991-233500013 CCACCATGCCCAGCTAATTTAGG - Intergenic
923399883 1:233606746-233606768 CCACCACACCCGGCTAATTTTGG - Intergenic
923612773 1:235510002-235510024 CCACCACTCCCGGCTAATTTTGG - Intergenic
924320530 1:242843991-242844013 CCACCATGCCTGGCTAATTTTGG + Intergenic
924353569 1:243145425-243145447 CCACCACGCCCGGCTAATTTTGG + Intronic
924432117 1:244006003-244006025 CCACCATGCCCAGCTAATTTTGG - Intergenic
924546715 1:245034446-245034468 CCACCATGCCTGGCTAATTTTGG - Intronic
1062968895 10:1630800-1630822 CCACCACACCTGGCTAATTTTGG - Intronic
1063026478 10:2183911-2183933 CCACCACACCAGGCTAATTTTGG + Intergenic
1063030529 10:2229838-2229860 CCACCATACCTGGCTAATTCAGG + Intergenic
1063160244 10:3413391-3413413 CCACCACACCTGGCTAATTTTGG - Intergenic
1063196220 10:3746402-3746424 CCACCGCACTCGGCTAATTTTGG + Intergenic
1063412621 10:5848204-5848226 CCACCACGCCCGGCTAATTTTGG + Intergenic
1063429912 10:5978741-5978763 CCACCATGCCCAGCTAATTTTGG - Intergenic
1063542919 10:6952748-6952770 CCACCACGCCCGGCTAATTTTGG - Intergenic
1063967327 10:11356636-11356658 CCACCACACCTGGCTAATTTTGG - Intergenic
1064125491 10:12656337-12656359 CCACCACACCCAGCTAATTTTGG - Intronic
1064177621 10:13088861-13088883 CCACCATACCTGACTAATTTTGG - Intronic
1064357216 10:14630696-14630718 CCATCATGCTTGGCTAATTTTGG - Intronic
1064451191 10:15443470-15443492 CCACCACACGTGGCTAATTTCGG + Intergenic
1064642281 10:17426947-17426969 CCACCATGCCTGGCTAATTTTGG - Intronic
1064692366 10:17931109-17931131 CCACCACACCCAGCTAATTTTGG + Intergenic
1064727719 10:18298214-18298236 CCACCATGCCCAGCTAATTTTGG - Intronic
1064920065 10:20506186-20506208 CCACCATTCCTGGCTAATTTTGG - Intergenic
1064971005 10:21067123-21067145 CCACCACGCCCGGCTAATTTTGG + Intronic
1065300956 10:24320892-24320914 CCACCACACCCGGCTAATTTTGG - Intronic
1065336685 10:24659466-24659488 CCACCACACCCGGCTAATTTTGG + Intronic
1066125658 10:32339390-32339412 CCACCATGCCCAGCTAATTTAGG - Intronic
1066362907 10:34748315-34748337 CCACCACACCCAGCTAATTTTGG - Intronic
1066373277 10:34835634-34835656 CCACCACACCTGGCTAATTTTGG + Intergenic
1067075077 10:43173838-43173860 CCACCACACCTGGCTAATTTTGG - Intronic
1067331072 10:45319671-45319693 CCACCACACCCAGCTAATTTTGG + Intergenic
1068629742 10:59286879-59286901 CCACCACACCCGGTTAATTTTGG - Intronic
1068984874 10:63098252-63098274 CCACCACGCCCGGCTAATTTTGG + Intergenic
1069023026 10:63510288-63510310 CCACCGCGCTCGGCCAATTTTGG + Intergenic
1069122686 10:64587366-64587388 CCACCATACCCAGCTAAGTTTGG + Intergenic
1069294326 10:66825426-66825448 CCACCACACCCGGCTAATTTTGG + Intronic
1069483023 10:68801032-68801054 CCACCATGCCTGGCTAATTTTGG - Intergenic
1069499239 10:68935680-68935702 CCACCATGCCCAGCTAATTTTGG - Intronic
1069937353 10:71926957-71926979 CCACCATGCCCGGCTAATTTGGG + Intergenic
1070063243 10:73006821-73006843 CCACCACACCCGGCTAATTTTGG + Intergenic
1070096830 10:73345650-73345672 CCACCATGCCTGGCTAATTTTGG - Intronic
1070179770 10:74002276-74002298 CCACCACGCCCGGCTAATTTTGG + Intronic
1070609055 10:77921056-77921078 CCACCCTGCATGGCTAATTTAGG - Intronic
1070615821 10:77968535-77968557 CCACCATGCCCGGCTAATTTTGG - Intergenic
1070904153 10:80056978-80057000 CCACCACACCTGGCTAATTTTGG - Intergenic
1070905811 10:80072196-80072218 CCACCATGCCCGGCTAATTTTGG + Intergenic
1071113772 10:82193293-82193315 CCACCATGCCCGGCTAATTTGGG + Intronic
1071139111 10:82486565-82486587 CCACCCCACCTGGCTAATTTTGG + Intronic
1071434302 10:85632694-85632716 CCACCACACCGGGCTAATTTTGG + Intronic
1071687424 10:87774798-87774820 CCACCACACCTGGCTAATTTTGG - Intronic
1071810889 10:89179619-89179641 CCGCCATGCCCGGCTAATTTTGG - Intergenic
1072098578 10:92207133-92207155 CCACCATGCCCTGCTAATTTTGG + Intronic
1072173163 10:92887550-92887572 CCACCACACCCAGCTAATTTTGG + Intronic
1072349574 10:94544203-94544225 CCACCACAGCCGGCTAATTTTGG + Intronic
1072454434 10:95563465-95563487 CCACCATGCCCAGCTAATTTTGG - Intergenic
1072581600 10:96744829-96744851 TCACCATATCCGGCTAATTTTGG + Intergenic
1073370222 10:102981541-102981563 CCACCACACCCGGCTAACTTTGG + Intronic
1073394034 10:103203505-103203527 CCACCACACCCGGCTAATTTTGG + Intergenic
1073415868 10:103381417-103381439 CCACCCTGCTTGGCTAATTTTGG + Intronic
1073483487 10:103801854-103801876 CCACCATGCCTGGCTAATTTTGG + Intronic
1073708396 10:106012943-106012965 CCACCATACCCTGATAATTTTGG + Intergenic
1073876295 10:107926044-107926066 CCACCGTACCTGGCTAATTTTGG + Intergenic
1074053105 10:109897804-109897826 CCACCACACCCAGCTAATTTTGG + Intronic
1074799657 10:116986879-116986901 CCACCACACCCAGCTAATTTTGG + Intronic
1075046664 10:119151666-119151688 CCACCATGCCCGGCTAATTTTGG + Intronic
1075246993 10:120831412-120831434 CCACCATGCCCAGCTAATTTTGG - Intergenic
1075374073 10:121963941-121963963 CCACCATGCCCGGCTAATTTTGG - Intronic
1075548078 10:123370605-123370627 CCACCCTCCTGGGTGAATTTTGG - Intergenic
1075555911 10:123431963-123431985 CCACCACACCCAGCTAATTTTGG - Intergenic
1075842002 10:125512647-125512669 CCACCATACCTGGCTAATTTTGG + Intergenic
1077054314 11:583362-583384 CCACCACGCCCGGCTAATTTTGG - Intronic
1077064357 11:633372-633394 CCACCATGCCCAGCTAATTTTGG - Intergenic
1077419227 11:2441840-2441862 CCACCACACCCAGCTAATTTTGG + Intergenic
1078211603 11:9274485-9274507 CCACCACACCCGGCTAATTTTGG - Intergenic
1078311345 11:10246434-10246456 CCACCATGCCCAGCTAATTTTGG + Intronic
1079504820 11:21141914-21141936 CCACCATGCTCAGCTAATTTTGG + Intronic
1080003832 11:27382862-27382884 CCACCATGCCCTGCTAATTTTGG - Intronic
1080510855 11:32969835-32969857 CCACCACACCTGGCTAATTTTGG + Intronic
1080857487 11:36124842-36124864 CCACCATGCCCAGCTAATTTTGG + Intronic
1081057998 11:38434806-38434828 CCACCATGCCTGGCTAATTTTGG + Intergenic
1081177201 11:39943777-39943799 CCACCACACCCGGCTATTTTTGG + Intergenic
1081553051 11:44131888-44131910 CCACCATGCCCGGCTAATTTTGG + Intronic
1081553459 11:44135542-44135564 CCACCACACCCAGCTAATTTTGG + Intronic
1081883994 11:46479044-46479066 CCACCATGCCTGGCTAATTTTGG - Intronic
1081892831 11:46558394-46558416 CCACCATGCCCAGCTAATTTTGG - Intronic
1082282644 11:50286751-50286773 CCACCACACCTGGCTAATTTTGG - Intergenic
1082824082 11:57565515-57565537 CTACCATGCCCGGCTAATTTTGG + Intronic
1083147553 11:60770443-60770465 CCACCACACCCAGCTAATTTTGG - Intronic
1083449158 11:62731039-62731061 CCACCATGCCTGGCTAATTTTGG + Intronic
1083786334 11:64950175-64950197 CCACCACACCCGGCTAATTTTGG - Intronic
1083788818 11:64971138-64971160 CCACCATACCCGGCTAATTTTGG - Intronic
1084499556 11:69526617-69526639 CCACCATACCTGGCTCATTTTGG - Intergenic
1084821191 11:71692107-71692129 CCACCACACGTGGCTAATTTTGG + Intergenic
1084920461 11:72465307-72465329 CCACCACACCCGGCTAATTTTGG + Intergenic
1085252969 11:75155608-75155630 CCACCATGCCCGGCTAATTTTGG + Intronic
1085542369 11:77284006-77284028 CCACCATGCCTGGCTAATTTTGG + Intronic
1085607793 11:77918282-77918304 CCACCACACCTGGCTAATTTTGG - Intronic
1085655429 11:78310213-78310235 CCACCGCACCCGGCTCATTTTGG - Intronic
1086310410 11:85530147-85530169 CCACCACACCCAGCTAATTTTGG + Intronic
1086446380 11:86875216-86875238 CCACCACACCCGGCTAATTGTGG - Intronic
1087043462 11:93824058-93824080 CCACCATGCCTGGCTAATTTTGG + Intronic
1087133218 11:94687242-94687264 CCACTATGCCCGGCTAATTTGGG - Intergenic
1087444005 11:98223501-98223523 CCACCACGCCCGGCTAATTTTGG + Intergenic
1087640730 11:100751930-100751952 CCACCATGCCCAGCTAATTTTGG + Intronic
1087654483 11:100905823-100905845 CCACCATTCCTGGCTAATTTTGG - Intronic
1088248578 11:107842670-107842692 CCGCCATACCTGGCTAATTTAGG + Intronic
1088680674 11:112239030-112239052 CCACCATGCCTGGCTAATTTTGG - Intronic
1089430439 11:118419600-118419622 CCACCATGCCTGGCTAATTTTGG - Intronic
1089544517 11:119212855-119212877 CCATCATGCTCAGCTAATTTTGG - Intronic
1089723083 11:120447663-120447685 CCACCATGCCTGGCTAATTTTGG - Intronic
1090024687 11:123157564-123157586 CCACCATGCCCAGCTAATTTTGG - Intronic
1090085228 11:123644617-123644639 CCACCATGCCCAGCTAATTTTGG - Intronic
1090325591 11:125883719-125883741 CCACCATGCCCAGCTAATTTTGG - Intronic
1091363554 11:134998275-134998297 CCACCACACTTGGTTAATTTTGG - Intergenic
1091729940 12:2873244-2873266 CCACCACACCTGGCTAATTTTGG - Intronic
1091751910 12:3027712-3027734 CCACCATGCCTGGCTAATTTTGG - Intronic
1091757717 12:3065944-3065966 CCACCACACCCTGCTAATTTTGG - Intergenic
1091758930 12:3074811-3074833 CCACCATACCCAGCTAATTGGGG - Intergenic
1092182274 12:6453860-6453882 CCACCATGCCCGGCTAATTTTGG - Intronic
1092295408 12:7193384-7193406 CCACCATGCCCGGCTAATTTTGG + Intronic
1092425483 12:8372166-8372188 CCACCATGCCTGGCTAATTTTGG + Intergenic
1092493645 12:8969961-8969983 CCACCATACCTGGCTAACTTTGG - Intronic
1092686831 12:11058081-11058103 CCACCTTGCCTGGCTAATTTTGG - Intronic
1092692328 12:11127955-11127977 CCACCATGCCCGGCTAACTTTGG - Intronic
1092811960 12:12279490-12279512 CCACCACACCCAGCTAATTTTGG + Intergenic
1093155166 12:15675445-15675467 CCACCACACCTGGCTAATTTTGG - Intronic
1093449819 12:19302546-19302568 CCACCACACCCAGCTAATTTTGG + Intronic
1093474830 12:19543417-19543439 CCACCATGCCTGGCTAATTTTGG + Intronic
1093486831 12:19661619-19661641 CCACCACACTCAGCTAATTTTGG - Intronic
1093568352 12:20635423-20635445 CCACCACGCCCGGCTAATTTTGG - Intronic
1093602003 12:21038562-21038584 CCCCCACACTTGGCTAATTTTGG - Intronic
1094354740 12:29565692-29565714 CCACCACACCTGGCTAATTTTGG - Intronic
1094390238 12:29941045-29941067 CCCCCCTACTCAGCAAATGTTGG + Intergenic
1094459996 12:30685770-30685792 CCACCATGCTTGGCTAATTTTGG - Intronic
1094607716 12:31963190-31963212 CCACCACACCTGGCTAATTTTGG - Intronic
1094642351 12:32288382-32288404 CCACCATACCTGGCTAATTTTGG + Intronic
1095189313 12:39237895-39237917 CCACCATGCCCAGCTAATTTTGG + Intergenic
1095196186 12:39320780-39320802 CCACCACACTCAGCTAATTTTGG - Intronic
1095723608 12:45427785-45427807 CCACCATGCCCGGCTAATTTTGG - Intronic
1095769380 12:45935903-45935925 CCACCCTACTTGTCTGTTTTTGG + Intronic
1095769418 12:45936292-45936314 CCACCACGCCCGGCTAATTTTGG + Intronic
1095769612 12:45938334-45938356 CCATCATGCCCGGCTAATTTTGG - Intronic
1096118179 12:49068586-49068608 CCACCATGCCCAGCTAATTTTGG + Intronic
1096266686 12:50128793-50128815 CTAACCTACTCCACTAATTTGGG + Intergenic
1096699864 12:53375373-53375395 CCACCACACCCAGCTAATTTTGG - Intergenic
1096827255 12:54289235-54289257 CCACCATGCCCAGCTAATTTTGG - Intergenic
1096985512 12:55753615-55753637 CCACCACGCCCGGCTAATTTTGG - Exonic
1097619916 12:61926920-61926942 CCACCATGCCCAGCTAATTTTGG - Intronic
1097690178 12:62727811-62727833 CCACCATGCCCGGCTAATTTTGG + Intronic
1098587901 12:72176216-72176238 CCACCACACCCAGCTAATTTGGG - Intronic
1098841076 12:75479081-75479103 CCACCATGCCAGGCTAATTTTGG + Intergenic
1098960157 12:76731629-76731651 CCACCATGCCCGGCTAATTTTGG + Intergenic
1099058694 12:77878376-77878398 CCACCATGCCTGGCTAATTTTGG + Intronic
1099197911 12:79640586-79640608 CCACCATACCCGGCTAATTTTGG - Intronic
1099338950 12:81402699-81402721 CCACCCTGCCTGGCTAATTTTGG - Intronic
1099786705 12:87273702-87273724 CCACCACACCTGGCTAATTTTGG + Intergenic
1099841962 12:87977238-87977260 CCACCACACCTGGCTAATTTTGG - Intergenic
1100314242 12:93429115-93429137 CCACCACACCCAGCTAATTTTGG - Intronic
1100314518 12:93432077-93432099 CCACCACACCCGGCTAATTTTGG - Intronic
1100438234 12:94591601-94591623 CCACCATGCCTGGCTAATTTTGG - Intronic
1100460454 12:94794250-94794272 CCACCACACCTGGCTAATTTTGG + Intergenic
1100977257 12:100135419-100135441 CCACCACGCTCGGCCAATTTTGG + Intronic
1101387205 12:104268370-104268392 CCACCATGCCCGGCTAATATGGG - Intronic
1101485181 12:105150629-105150651 CCACCATGCCCGGCTAATTTTGG - Intronic
1101704081 12:107204349-107204371 CCACCACACCCAGCTAATTTTGG + Intergenic
1102138309 12:110593669-110593691 CCACCACACCCAGCTAATTTAGG + Intergenic
1102165012 12:110799098-110799120 CCACCACACCTGGCTAATTTTGG + Intergenic
1102361298 12:112290166-112290188 CCACCTTGCTGGGCTAATTTTGG - Intronic
1102362393 12:112299468-112299490 CCACCATGCCTGGCTAATTTTGG - Intronic
1102378496 12:112443509-112443531 CCACCTTGCCCAGCTAATTTTGG + Intronic
1102503264 12:113367595-113367617 CCACCACACCCAGCTAATTTTGG - Intronic
1102549302 12:113679588-113679610 CCACCACACCCAGCTAATTTTGG - Intergenic
1102550440 12:113687977-113687999 CCACCATGCCCGGTTAATTTTGG + Intergenic
1102660332 12:114521530-114521552 CCACCATGCCCGGCTAATTTTGG - Intergenic
1102850429 12:116238940-116238962 CCACCACGCCCGGCTAATTTTGG - Intronic
1102918051 12:116769880-116769902 CCACCACACCTGGCTAATTTTGG - Intronic
1102948172 12:117008912-117008934 CCACCACACCTGGCTAATTTTGG - Intronic
1103108185 12:118249673-118249695 CCACCACACCCAGCTAATTTTGG - Intronic
1103211004 12:119166357-119166379 CCACCACACCCAGCTAATTTTGG - Intergenic
1103232718 12:119345347-119345369 CCACCACACCTGGCTAATTTTGG - Intronic
1103308358 12:119985253-119985275 CCCCCACACTTGGCTAATTTTGG - Intergenic
1103370629 12:120416569-120416591 CCACCACACCTGGCTAATTTTGG - Intergenic
1103372483 12:120430069-120430091 CCACCATGCCCAGCTAATTTTGG - Intergenic
1103545389 12:121697607-121697629 GCACCATGCCCGGCTAATTTTGG + Intergenic
1103684739 12:122723084-122723106 CCACCATGCCCAGCTAATTTTGG - Intergenic
1103686291 12:122734624-122734646 CCACCACACCCGGCTAGTTTTGG - Intergenic
1104176425 12:126337280-126337302 CCACCATGCCCAGCTAATTTTGG + Intergenic
1104244153 12:127021356-127021378 CCAGCATGCTTGGCTAATTTTGG - Intergenic
1104867503 12:131966749-131966771 CCACCATGCCCGGCTAATTGTGG - Intronic
1105219046 13:18308608-18308630 CTACCCTGCCTGGCTAATTTTGG - Intergenic
1105469004 13:20674864-20674886 CCACCACGCCCGGCTAATTTTGG + Intronic
1105491769 13:20895023-20895045 CCACCATGCCTGGCTAATTTTGG - Intronic
1105548558 13:21370210-21370232 CCACTATGCCCGGCTAATTTTGG - Intergenic
1105740385 13:23317040-23317062 CCACCATGCCCGGCTAATCTTGG - Intronic
1105861651 13:24420409-24420431 CCACCACACCCAGCTAATTTTGG - Intergenic
1105871647 13:24510946-24510968 CCACCATGCCCAGCTAATTTTGG + Intronic
1105918240 13:24937474-24937496 CCACCACACCCAGCTAATTTTGG + Intergenic
1106218076 13:27720722-27720744 CCACCCTACCCAGCTGATTTTGG - Intergenic
1106247025 13:27959259-27959281 CCACCATGCCCGGCTAATTTTGG - Intergenic
1106491422 13:30226921-30226943 CCACCACACCCAGCTAATTTTGG - Intronic
1106791883 13:33163435-33163457 CCACCACACCTGGCTAATTTTGG - Intronic
1107463453 13:40627678-40627700 CCACCATGCCTGGCTAATTTTGG - Intronic
1107496163 13:40927833-40927855 CCACCACGCCCGGCTAATTTTGG - Intergenic
1107604414 13:42043490-42043512 CCACCATGCTGGGCTCATTTTGG + Intronic
1107846169 13:44515588-44515610 CCACCATACCCGGCTAATTTTGG + Intronic
1108174040 13:47773879-47773901 CCACCACGCCCGGCTAATTTTGG + Intergenic
1108371377 13:49772648-49772670 CCACCATGCCCTGCTAATTTTGG - Intronic
1108540502 13:51440103-51440125 CCACCACACCTGGCTAATTTTGG - Intronic
1108554351 13:51578472-51578494 CCACCATGCCTGGCTAATTTTGG - Intergenic
1108639083 13:52365304-52365326 CCACCATACCCGGCTAATTTTGG - Intergenic
1108650859 13:52478257-52478279 CCACCATACCCGGCTAATTTTGG + Intergenic
1108746196 13:53397136-53397158 CCACCCTGCTTGGCTAGTTTTGG + Intergenic
1108779633 13:53813447-53813469 CCACCATGCCCTGCTAATTTTGG + Intergenic
1109045252 13:57402345-57402367 CCACTATGCTCGGCAAATTTTGG - Intergenic
1109271806 13:60264009-60264031 CCACCATACCCAGCTAACTTTGG + Intergenic
1109564603 13:64095678-64095700 CCACCATGCCTGGCTAATTTTGG - Intergenic
1109720044 13:66264251-66264273 CCACCACACTCAGCTAATTGTGG + Intergenic
1109869005 13:68305875-68305897 CCACCCCGCCAGGCTAATTTTGG + Intergenic
1110224323 13:73104153-73104175 CCACCAAGCCCGGCTAATTTTGG + Intergenic
1110234540 13:73202773-73202795 CCACCATGTCCGGCTAATTTTGG + Intergenic
1110234843 13:73205854-73205876 CCACCAAACATGGCTAATTTTGG - Intergenic
1110323524 13:74187173-74187195 CCACCATACCCAGCTAATTCTGG - Intergenic
1110432764 13:75444284-75444306 CCACCATGCTCGGCTCATTGAGG + Intronic
1111014156 13:82355434-82355456 CCACCATGCCAGGCTAATTTTGG + Intergenic
1111059221 13:82990508-82990530 CCACGACACCCGGCTAATTTTGG - Intergenic
1111069573 13:83147208-83147230 CCACCACACTCAGCTAATTTTGG - Intergenic
1111185516 13:84729151-84729173 CCACTCTGCTAGGCTATTTTAGG + Intergenic
1111562558 13:89969995-89970017 CCACCACACCCAGCTAATTTTGG - Intergenic
1111635901 13:90903366-90903388 CCACCGTACCAAGCTAATTTGGG - Intergenic
1111704657 13:91733285-91733307 CCACCACACCTGGCTAATTTTGG + Intronic
1111709132 13:91789059-91789081 CCACCATGCCCAGCTAATTTTGG - Intronic
1111732568 13:92095685-92095707 CCACCATGCCCGGCTAATTTTGG + Intronic
1111868176 13:93796041-93796063 CCACCATACTCAGCTGCTTTTGG - Intronic
1111940149 13:94599702-94599724 CCACCACACCTGGCTAATTTTGG - Intergenic
1112289073 13:98128955-98128977 CCACCATGCCCAGCTAATTTTGG - Intergenic
1112356749 13:98679851-98679873 CCACCATGCCTGGCTAATTTTGG - Intergenic
1112409313 13:99148607-99148629 CCACCACACCCGGCTAATTTTGG + Intergenic
1113009033 13:105742154-105742176 CCACCCCACCCGGCCAAATTAGG + Intergenic
1113791730 13:113032720-113032742 CCACCACACCCGGCTAATTTGGG + Intronic
1114006750 14:18322025-18322047 CCACCACGCCCGGCTAATTTTGG - Intergenic
1114293185 14:21305706-21305728 CCATCACACCCGGCTAATTTTGG - Intronic
1114401924 14:22418008-22418030 CCACCCTGGTCAGCTAATCTAGG + Intergenic
1114430957 14:22660166-22660188 CCACCACGCCCGGCTAATTTTGG - Intergenic
1114488794 14:23082890-23082912 CCACCATACCTGGCTAATTTCGG + Intronic
1114667724 14:24390150-24390172 CCACCAGACACAGCTAATTTTGG + Intergenic
1115071530 14:29328653-29328675 CCACCACACCCAGCTAATTTTGG + Intergenic
1115500944 14:34049316-34049338 CCACCATGCCCAGCTAATTTTGG + Intronic
1115559138 14:34567197-34567219 CCACCGTACCCGGCTAGTCTGGG - Intronic
1115685564 14:35792628-35792650 CCGCCATACCCGGCTAGTTTTGG - Intronic
1116886515 14:50227394-50227416 CCACCACACTTGGCTAATTTTGG + Intronic
1116994232 14:51305577-51305599 CCACCACACCTGGCTAATTTTGG - Intergenic
1116998736 14:51351133-51351155 CCACCATGCCCGGCTAATTTTGG - Intergenic
1117016156 14:51519315-51519337 CCACCATACCCAGCTAATTTTGG + Intronic
1117442927 14:55777025-55777047 CCACCACACCTGGCTAATTTTGG - Intergenic
1117572651 14:57063036-57063058 CCACGATGCCCGGCTAATTTCGG + Intergenic
1118045652 14:61968106-61968128 CCACCATACCCAGCTAATTTTGG - Intergenic
1118217611 14:63824184-63824206 CTACCATGCTCGGCTAACTTTGG - Intergenic
1118281512 14:64433269-64433291 CCACCATGCCCAGCTAATTTTGG + Intronic
1118586930 14:67362170-67362192 CCACCACACCCAGCTAATTTTGG + Intronic
1118618333 14:67591682-67591704 CCACCATGCTCAGCTAATTTTGG + Intronic
1118979744 14:70706869-70706891 CCACCACCCCCGGCTAATTTTGG - Intergenic
1119274050 14:73337077-73337099 CCACCACGCCCGGCTAATTTTGG - Intronic
1119381778 14:74233708-74233730 CCACCATACCCGGCTAATTGAGG - Intergenic
1119387765 14:74268503-74268525 CCACCACACCCGGCTATTTTTGG - Intergenic
1119496819 14:75086751-75086773 CCACCATGCCCGGCTAATTTTGG - Intronic
1120202976 14:81557936-81557958 CCACCACACCTGGCTAATTTTGG + Intergenic
1120367783 14:83592289-83592311 CCACCACGCTCGGCTAGTTTTGG - Intergenic
1120934198 14:89877190-89877212 CCACCACACCTGGCTAATTTTGG + Intronic
1120962932 14:90141608-90141630 CCACCACACCTGGCTAATTTTGG + Intronic
1121008586 14:90506314-90506336 CCACCATGCCCGGCTAATTTTGG - Intergenic
1121349343 14:93161093-93161115 CCACCATGCCTGGCTAATTTTGG - Intergenic
1121537163 14:94698896-94698918 CCACCACACCCAGCTAATTTTGG + Intergenic
1121540887 14:94725545-94725567 CCACCATGCCTGGCTAATTTTGG + Intergenic
1121557948 14:94852401-94852423 CCACCATGCCCAGCTAATTTTGG - Intergenic
1121569072 14:94933010-94933032 CCACCATGCCCGGCTAATTTTGG + Intergenic
1122060091 14:99131463-99131485 CCACCATGCCCAGCTAATTTTGG - Intergenic
1122754110 14:103964091-103964113 CCACCATATTCCACTAATTTTGG - Intronic
1122872928 14:104649510-104649532 CCACCACGCCCGGCTAATTTTGG + Intergenic
1123082271 14:105701111-105701133 CCACCCCACAGGGCTATTTTGGG + Intergenic
1202939245 14_KI270725v1_random:129400-129422 CCACCATGCCAGGCTAATTTTGG - Intergenic
1202942178 14_KI270725v1_random:161486-161508 CCTCCCTACTCTGATTATTTAGG + Intergenic
1123710624 15:22984465-22984487 CCACCACACCCAGCTAATTTTGG - Intronic
1123818776 15:24005535-24005557 CCACCATGCCCGGCTAATTTTGG + Intergenic
1124032359 15:26023092-26023114 CCACCATGCCCGGCTAATTTGGG + Intergenic
1124055928 15:26241006-26241028 CCACCATGCCCAGCTAATTTTGG - Intergenic
1124354913 15:28987908-28987930 CCACCACACCTGGCTAATTTGGG + Intronic
1124626612 15:31311432-31311454 CCACCACTCCCGGCTAATTTTGG + Intergenic
1125628703 15:41130245-41130267 CCACCACGCTGGGCTAATTTTGG - Intergenic
1125708488 15:41764004-41764026 CCACCACATCCGGCTAATTTTGG - Intronic
1125822378 15:42643347-42643369 CCACCATGCCTGGCTAATTTTGG + Intronic
1125908488 15:43415359-43415381 CCACCACACTCAGCTAATTCTGG + Intronic
1125925312 15:43558378-43558400 CCACCGCACCCAGCTAATTTTGG + Intronic
1126147981 15:45494998-45495020 CCACCACACTTGGCCAATTTTGG - Intronic
1126165961 15:45653967-45653989 CCACCATGCCTGGCTAATTTTGG - Intronic
1126414595 15:48404654-48404676 CCACCATACCTGGCTAATTTGGG + Intergenic
1126636591 15:50786116-50786138 CCACCATGCTTGGCTAATTTTGG + Intergenic
1127085852 15:55423935-55423957 CCACCATGCCCGGCTAATTTTGG - Intronic
1127722174 15:61713827-61713849 CTACCACACTCTGCTAATTTTGG + Intergenic
1127979986 15:64027414-64027436 CCACCATACCTGGCTAATTTTGG - Intronic
1128012503 15:64311196-64311218 CCACCATGCCCAGCTAATTTTGG + Intronic
1128143320 15:65317323-65317345 CCACCACACCTGGCTAATTTTGG - Intergenic
1128270453 15:66304746-66304768 CCACCATGCCTGGCTAATTTTGG - Intronic
1128274021 15:66337472-66337494 CCACTACACCCGGCTAATTTTGG + Intronic
1128634025 15:69291479-69291501 CCACCACACCCAGCTAATTTTGG + Intergenic
1128754856 15:70174906-70174928 CCACCATGCCTGGCTAATTTTGG + Intergenic
1128787597 15:70409821-70409843 CCACCATGCCCGGTTAATTTTGG + Intergenic
1128980593 15:72183023-72183045 CCACCATGCCCAGCTAATTTTGG + Intronic
1129141742 15:73604943-73604965 CCACCATGCTCAGCTATTTTTGG - Intronic
1129750663 15:78060762-78060784 CCACCACACCTGGCTAATTTTGG - Intronic
1129803344 15:78433887-78433909 CCACCATGCCCAGCTAATTTTGG - Intergenic
1129939143 15:79478664-79478686 CCACCATGCCCGGCCAATTTTGG - Intergenic
1130153714 15:81332208-81332230 CCACCTAACTCGGATAAATTTGG + Exonic
1130228528 15:82078680-82078702 CCACCACGCTCGGCTACTTTTGG - Intergenic
1131274842 15:90972228-90972250 CCACCATACCCGGCTAATTTTGG - Intronic
1132191669 15:99867592-99867614 CCACCACACCCAGCTAATTTTGG + Intergenic
1132233756 15:100203744-100203766 CCACCATGCCTGGCTAATTTGGG - Intronic
1132737923 16:1396437-1396459 CCACCACACCCAGCTAATTTTGG + Intronic
1133045958 16:3088464-3088486 CCACCACGCCCGGCTAATTTTGG + Intergenic
1133075086 16:3273915-3273937 CCACCACGCTCAGCTAATTTTGG + Intronic
1133197647 16:4182889-4182911 CCACCATGCCCGGCTAATTTAGG - Intergenic
1133261454 16:4553488-4553510 CCACCATGCCCAGCTAATTTTGG + Intergenic
1133341504 16:5039461-5039483 CCACCACACCCGGCTAATTTTGG - Intronic
1133361580 16:5178097-5178119 CCACCATACTCAGCTAGTTTTGG + Intergenic
1133365305 16:5204248-5204270 CCACCATGCCCGGATAATTTTGG + Intergenic
1133408312 16:5545127-5545149 CCACCATGCCTGGCTAATTTTGG + Intergenic
1133457572 16:5956121-5956143 CCACCACACCTGGCTAATTTTGG - Intergenic
1133476942 16:6132832-6132854 CCACCATGCCCAGCTAATTTTGG - Intronic
1133558778 16:6930560-6930582 CCACCATGCCTGGCTAATTTTGG + Intronic
1133746843 16:8693619-8693641 CCATGATACTGGGCTAATTTTGG + Intronic
1133753716 16:8745542-8745564 CCACCATGCCTGGCTAATTTTGG - Intronic
1133800725 16:9082904-9082926 CCACCATGCCGGGCTAATTTTGG + Intergenic
1133870100 16:9677942-9677964 CCACCATGCCTGGCTAATTTTGG - Intergenic
1134060771 16:11198295-11198317 CCACCCTGCCTGGCGAATTTTGG - Intergenic
1134130813 16:11648746-11648768 CCACCATGCCCAGCTAATTTTGG - Intergenic
1134171089 16:11970363-11970385 CCACCATGCTCAGCTAGTTTTGG + Intronic
1134191829 16:12127572-12127594 CCACCATGCCCGGCTAATTTTGG + Intronic
1134287395 16:12873899-12873921 CCACCATGCCCAGCTAATTTAGG - Intergenic
1134289881 16:12895856-12895878 CCACCATGCACGACTAATTTTGG + Intergenic
1134391145 16:13821304-13821326 CCACCATGCCTGGCTAATTTTGG + Intergenic
1134625965 16:15722894-15722916 CCACCACGCCCGGCTAATTTTGG + Intronic
1135062079 16:19279603-19279625 CCACCATGCCTGGCTAATTTTGG + Intergenic
1135096818 16:19571367-19571389 CCACCGCACTCAGCTAATTTTGG + Intronic
1135127896 16:19826528-19826550 CCACCGCACTCAGCTAATTTTGG + Intronic
1135291259 16:21240941-21240963 CCACCATGCCCAGCTAATTTTGG + Intronic
1135566184 16:23512855-23512877 CCACCACACCCGGCTAATTTTGG + Intronic
1135566373 16:23514257-23514279 CCACCATGCCTGGCTAATTTTGG + Intronic
1135713202 16:24736010-24736032 CCACCACACCAGGCTAATTTTGG - Intronic
1135784076 16:25332316-25332338 CCACCACACCTGGCTAATTTTGG - Intergenic
1135922805 16:26666304-26666326 CCACCATACCCGGCTAATTTTGG - Intergenic
1136340524 16:29640093-29640115 CCACCATGCCCAGCTAATTTTGG - Intergenic
1136480484 16:30538737-30538759 CCACCACACCCGGCTAATTTTGG + Intronic
1136504339 16:30693337-30693359 CCACCACACCCAGCTAATTTTGG + Intergenic
1136521093 16:30796326-30796348 CCACCATGCTGGGCTAATTTTGG + Intergenic
1137243241 16:46677686-46677708 CCACCATGCCCAGCTAATTTTGG + Intronic
1137511722 16:49106586-49106608 CAACCACACTCTGCTAATTTGGG - Intergenic
1137841981 16:51649322-51649344 CCACCATGCCTGGCTAATTTTGG + Intergenic
1138061093 16:53891141-53891163 CCACCATGCCTGGCTAATTTTGG + Intronic
1138444789 16:57056809-57056831 CCACCATGCCTGGCTAATTTTGG + Intronic
1138727924 16:59161284-59161306 CCACCATGCCTGGCTAATTTTGG + Intergenic
1139045558 16:63054781-63054803 CCACCATGCCCAGCTAATTTAGG + Intergenic
1139703717 16:68725900-68725922 CCACCATGCCCAGCTAATTTAGG - Intergenic
1139786016 16:69392637-69392659 CCACTGCACCCGGCTAATTTTGG + Intronic
1139828259 16:69774815-69774837 CCACCATGCCTGGCTAATTTTGG - Intronic
1139833232 16:69817809-69817831 TCACCATGCTTGGCTAATTTTGG + Intronic
1139904943 16:70358181-70358203 CCACCACACCTGGCTAATTTTGG + Intronic
1140382832 16:74505875-74505897 GCACCACACTCAGCTAATTTTGG - Intronic
1140415754 16:74773026-74773048 CCACCACACCCGGCTAATTTTGG + Intronic
1140889801 16:79275201-79275223 CCACCACACCCAGCTAATTTGGG - Intergenic
1140986318 16:80161025-80161047 CCACCACACCCAGCTAATTTTGG - Intergenic
1141095134 16:81157816-81157838 CCACCACACCCGGTTAATTTGGG + Intergenic
1141732495 16:85832276-85832298 CCACCACACCCAGCTAATTTTGG - Intergenic
1141739453 16:85881214-85881236 CCACCATGCTGGGCTAATTTTGG - Intergenic
1141915311 16:87092521-87092543 CCACCATCCCCGGCTAATTTTGG - Intronic
1142517130 17:439543-439565 CCACCATACCTGGCTAATTTTGG + Intergenic
1142566701 17:844735-844757 CCACCATACCCGGCTAATTTTGG + Intronic
1142972238 17:3620711-3620733 CCACCACACCTGGCTAATTTTGG + Intronic
1143122106 17:4614876-4614898 CCACCACACCCGGCTAATTTTGG + Intergenic
1143214983 17:5218176-5218198 CCACCACACCTGGCTAATTTTGG + Intronic
1143222750 17:5276274-5276296 CCACCATGCCCGGCTAATTAAGG - Intergenic
1143466156 17:7138080-7138102 CCACCATGCCCGGCTAATTTTGG + Intergenic
1143469663 17:7164538-7164560 CCACCATGCCCGGCTTATTTTGG + Intergenic
1143801122 17:9381814-9381836 CCACCATGCCCAGCTAATTTTGG - Intronic
1144222044 17:13108307-13108329 CCACCATGCCCAGCTAATTTTGG - Intergenic
1144224410 17:13131013-13131035 CCACCATGCCCAGCTAATTTTGG - Intergenic
1144230816 17:13201514-13201536 CCACCGCACCTGGCTAATTTTGG + Intergenic
1144271622 17:13623240-13623262 CCACCACGCTCAGCTAATTTTGG + Intergenic
1144367384 17:14557376-14557398 CCACCATGCCCAGCTAATTTTGG - Intergenic
1144561501 17:16324107-16324129 CCACCATGCCCAGCTAATTTTGG + Intronic
1144664753 17:17094761-17094783 CCACCATGCCTGGCTAATTTTGG + Intronic
1144810066 17:17993331-17993353 CCACCACACCTGGCTAATTTTGG - Intronic
1144970607 17:19106905-19106927 CCACCATGCCCAGCTAATTTTGG - Intergenic
1144970629 17:19107042-19107064 CCACCATGCCCAGCTAATTTTGG - Intergenic
1144990910 17:19233067-19233089 CCACCATGCCCAGCTAATTTTGG - Intronic
1144990932 17:19233204-19233226 CCACCATGCCCAGCTAATTTTGG - Intronic
1145020668 17:19428108-19428130 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145020772 17:19429065-19429087 CCACCATGCCTGGCTAATTTTGG + Intergenic
1145059905 17:19726174-19726196 CCACCACACCCAGCTAATTTTGG + Intergenic
1145113428 17:20185988-20186010 CCACCACACCCAGCTAATTTTGG + Intronic
1145217525 17:21063212-21063234 CCACCACACCTGGCTAATTTTGG + Intergenic
1146207603 17:30918353-30918375 CCACCATAGCCAGCTAATTTTGG + Intronic
1146211288 17:30945601-30945623 CCACCATGCTTAGCTAATTTTGG - Intronic
1146325406 17:31881844-31881866 CCACCATACCCAGCTAATTTTGG + Intronic
1146378188 17:32308911-32308933 CCACCACACCTGGCTAATTTTGG - Intronic
1146391453 17:32427253-32427275 CCACCATGCCCGGCTAATTTTGG + Intergenic
1146850403 17:36216611-36216633 CCACCTCACCCAGCTAATTTTGG - Intronic
1147171993 17:38626741-38626763 CCACCATGCCCGGCTGATTTTGG + Intergenic
1147271899 17:39278990-39279012 CCACCATGCCTGGCTAATTTTGG - Intronic
1147378856 17:40040229-40040251 CCACCATGCCCGGCTAATTTTGG + Intronic
1147423310 17:40333200-40333222 CCACCATGCCCGGCTACTTTTGG + Intronic
1147598083 17:41729395-41729417 CCACCATGCACAGCTAATTTTGG - Intronic
1147682064 17:42255933-42255955 CCACCATGCCTGGCTAATTTTGG - Intronic
1147778410 17:42920703-42920725 CCACCATGCCTGGCTAATTTTGG + Intergenic
1147844205 17:43393498-43393520 CCACCATGCCCGGCTAATTTTGG - Intergenic
1147859472 17:43509634-43509656 CCACCATTCTTGGCTAATTTTGG + Intronic
1147983369 17:44289015-44289037 CCACCATGCCCGGCTAAATTTGG + Intergenic
1148256976 17:46143339-46143361 CCACCACACCTGGCTAATTTTGG - Intronic
1148320492 17:46747431-46747453 CCACCACACCCGGCTAATTTTGG + Intronic
1148382214 17:47208279-47208301 CCAGCACACTTGGCTAATTTTGG - Intronic
1148925910 17:51085001-51085023 CCACCATGCCTGGCTAATTTTGG + Intronic
1149779413 17:59385423-59385445 CCACCATGCCTGGCTAATTTTGG - Intronic
1149930925 17:60754355-60754377 CCACCATACCTGGCTAATTACGG + Intronic
1150111587 17:62504994-62505016 CCACCATGCCTGGCTAATTTTGG + Intronic
1150332816 17:64308084-64308106 CCACCATGCCCAGCTAATTTTGG - Intergenic
1150345250 17:64399529-64399551 CCACCACATCCGGCTAATTTTGG + Intronic
1150412876 17:64961607-64961629 CCACCACACCTGGCTAATTTTGG - Intergenic
1150438182 17:65170205-65170227 CCACCATGTCCGGCTAATTTTGG + Intronic
1150688473 17:67341314-67341336 CCACCATGCCTGGCTAATTTTGG - Intronic
1150760151 17:67954148-67954170 CCACCCTGTCTGGCTAATTTTGG + Intronic
1150762122 17:67971649-67971671 CCACCATGCCCGACTAATTTTGG - Intronic
1150798961 17:68263620-68263642 CCACCACACCTGGCTAATTTTGG + Intronic
1150895448 17:69204973-69204995 CCACCACACCCAGCTAATTTTGG - Intronic
1151334756 17:73433437-73433459 CCACCATGCCCGGCTAATTTTGG + Intronic
1151584533 17:75001079-75001101 CCACCATGCCTGGCTAATTTTGG - Intronic
1151734796 17:75932590-75932612 CCGGCCCACCCGGCTAATTTTGG - Intronic
1151812932 17:76455296-76455318 CCACCTTGCCCAGCTAATTTTGG - Intronic
1151937095 17:77269002-77269024 CCACCAGGCCCGGCTAATTTTGG - Intergenic
1152055414 17:78021720-78021742 CCACCATGCCCAGCTAATTTTGG + Intronic
1152175796 17:78786343-78786365 CCACCAAGCCCGGCTAATTTTGG - Intergenic
1152422096 17:80199105-80199127 CTACCGTGCCCGGCTAATTTGGG + Intronic
1152981696 18:284024-284046 CCACCACGCCCGGCTAATTTTGG - Intergenic
1153060359 18:988817-988839 CCACCATGCCTGGCTAATTTTGG + Intergenic
1153106623 18:1535446-1535468 CCACCACACCTGGCTAATTTTGG - Intergenic
1153198492 18:2626109-2626131 CCACCATGCCTGGCTAATTTGGG + Intergenic
1153237846 18:3005522-3005544 CCACCATCCCCGGTTAATTTTGG - Intronic
1153302054 18:3599769-3599791 CCACCACGCCCGGCTAATTTTGG + Intronic
1153452347 18:5243779-5243801 CCACCATGCCCGGCTAATTTTGG - Intergenic
1153652264 18:7251391-7251413 CCAACACACCCGGCTAATTTTGG + Intergenic
1153901109 18:9617496-9617518 CCACCACACCCAGCTAATTTTGG + Intergenic
1153903704 18:9641577-9641599 GCAACCTACTCTGCTGATTTTGG - Intergenic
1154308474 18:13248111-13248133 CCACCATGCCTGGCTAATTTTGG + Intronic
1154484331 18:14860855-14860877 CCACCACACTTGGCAAATTTTGG + Intergenic
1154515271 18:15157376-15157398 CCACCACACCCAGCTAATTTTGG - Intergenic
1154530715 18:15341976-15341998 CCACCATGCCCGGCTAATTTTGG + Intergenic
1154952763 18:21226380-21226402 CCACCATACCTGGCTAATTTTGG + Intergenic
1154981220 18:21504084-21504106 CCACCACACCCAGCTAATTTTGG + Intronic
1154999060 18:21669094-21669116 CCACCACACCTGGCTAATTTTGG - Intronic
1155204398 18:23545393-23545415 CCACCAGGCCCGGCTAATTTTGG + Intronic
1155255583 18:23995315-23995337 CCACCACACCTGGCTAATTTTGG - Intronic
1155281019 18:24240074-24240096 CCACCACACCTGGCTAATTTTGG + Intronic
1155306014 18:24479068-24479090 CCACCATGCCTGGCTAATTTTGG + Exonic
1155469068 18:26171579-26171601 CCACCAAGCCCGGCTAATTTTGG - Intronic
1155483590 18:26316541-26316563 CCACCACACCCAGCTAATTTTGG + Intronic
1156087777 18:33428577-33428599 CCACCATGCCCAGCTAATTTTGG - Intronic
1156261596 18:35449408-35449430 CCACCATGCCTGGCTAATTTTGG - Intronic
1157253428 18:46116406-46116428 CCACCATGCCTGGCTAATTTTGG - Intronic
1157285657 18:46375399-46375421 CCACCATACCCAGCTAATTTTGG - Intronic
1157290204 18:46404598-46404620 CCACCATGCCCTGCTAATTTTGG - Intronic
1157346624 18:46842071-46842093 CCACCACACCTGGCTAATTTTGG - Intronic
1157373977 18:47146074-47146096 CCACCATGCCCAGCTAATTTTGG - Intronic
1157748943 18:50161229-50161251 CCACCATGCCCGGCTAATTTTGG - Intronic
1157996087 18:52557810-52557832 CCACCATGCCTGGCTAATTTTGG + Intronic
1158308231 18:56129671-56129693 CCAGCATCCTCGGGTAATTTAGG - Intergenic
1158539299 18:58338360-58338382 CCACCCTGCACGGCTAGTTGAGG - Intronic
1158625926 18:59071656-59071678 CCACCATGCCTGGCTAATTTTGG + Intergenic
1158715962 18:59880099-59880121 CCACCACGCTGGGCTAATTTTGG + Intergenic
1158919772 18:62178386-62178408 CCACCGTACTCTGCCATTTTCGG + Intronic
1159129580 18:64265947-64265969 CCACCATGCCCAGCTAATTTTGG + Intergenic
1159206578 18:65261291-65261313 CCACCACCCTTGGCTAATTTTGG + Intergenic
1160201926 18:76802780-76802802 CCACCAAGCCCGGCTAATTTTGG - Intronic
1160444859 18:78919358-78919380 CCACCACACCTGGCTAATTTGGG + Intergenic
1160741356 19:687557-687579 CCACCACACCTGGCTAATTTTGG + Intronic
1160829991 19:1099425-1099447 CCACCATGCTCGGCTAATTTTGG - Intergenic
1161097011 19:2398034-2398056 CCACCATGCCCAGCTAATTTGGG + Intronic
1161157683 19:2741502-2741524 CCACCATGCCTGGCTAATTTTGG - Intergenic
1161158482 19:2747918-2747940 CCACCACGCCCGGCTAATTTTGG + Intergenic
1161160674 19:2760363-2760385 CCACCATGCCTGGCTAATTTTGG - Intronic
1161182625 19:2894669-2894691 CCACCACACCCAGCTAATTTTGG + Intergenic
1161238703 19:3210238-3210260 GCACCATACTCGGCTAGCTTTGG + Intergenic
1161343670 19:3756324-3756346 CCACCATGCCCAGCTAATTTTGG - Intronic
1161387393 19:4003033-4003055 CCACCACACTCAGCTAATTTTGG - Intergenic
1161508794 19:4658953-4658975 CCACCATCCTTGGCTAATTTTGG + Intronic
1161621628 19:5300616-5300638 CCACCATGCCCGGCTAATTTTGG - Intronic
1162103779 19:8357182-8357204 CCACCACACCAGGCTAATTTTGG - Intronic
1162131327 19:8527763-8527785 CCACCATGCCCAGCTAATTTTGG + Intronic
1162412099 19:10512556-10512578 CCATCACACTTGGCTAATTTTGG + Intergenic
1162616812 19:11808227-11808249 CCACCACACCCGGCTAACTTTGG - Intronic
1162624400 19:11872928-11872950 CCACTATACCTGGCTAATTTTGG - Intronic
1162839913 19:13348853-13348875 CCACCACACCCAGCTAATTTTGG - Intronic
1162933260 19:13967627-13967649 CCACCACACCCGGCTAATTTTGG + Intronic
1163071513 19:14845998-14846020 CCACCATGCCAGGCTAATTTTGG - Intergenic
1163137091 19:15319781-15319803 CCACCACACTCATCTAATTTTGG - Intronic
1163150770 19:15412227-15412249 CCACCACACCCAGCTAATTTTGG - Intronic
1163260441 19:16186418-16186440 CCACCACACCTGGCTAATTTTGG + Intronic
1163268890 19:16237578-16237600 CCACCATGCCTGGCTAATTTTGG - Intronic
1163416553 19:17190344-17190366 CCACCATTCCTGGCTAATTTTGG + Intronic
1163434509 19:17287276-17287298 CCACCATGCCCAGCTAATTTTGG - Exonic
1163733632 19:18965035-18965057 CCACCATGCCCAGCTAATTTTGG + Intergenic
1163763340 19:19148862-19148884 CCACCACACCTGGCTAATTTGGG + Intronic
1163841452 19:19613313-19613335 CCACCACGCCCGGCTAATTTTGG - Intronic
1163850103 19:19657858-19657880 CCACCCTACTCGACCCATTCTGG - Intronic
1163859803 19:19736423-19736445 CCACCATACTCAGCCAATTTAGG + Intergenic
1164094546 19:21995102-21995124 CCACCACACCCAGCTAATTTGGG + Intronic
1164138362 19:22434483-22434505 CCACCATGCCCAGCTAATTTTGG - Intronic
1164563028 19:29307301-29307323 CCACCACACCCAGCTAATTTGGG + Intergenic
1164584039 19:29454462-29454484 CCACCACACCCTGCTAATTTTGG - Intergenic
1164838662 19:31375682-31375704 CCACCACACCCGGCTTATTTTGG + Intergenic
1165017020 19:32888960-32888982 CCACCATGCCCAGCTAATTTGGG + Intronic
1165044635 19:33095009-33095031 CCACCACACCTGGCTAATTTTGG - Intronic
1165192281 19:34074997-34075019 CCACCATGCCCGGCTAATTTTGG + Intergenic
1165203501 19:34164636-34164658 CCACCACACCCAGCTAATTTTGG + Intergenic
1165409042 19:35647415-35647437 CCACCACTCCCGGCTAATTTTGG - Intergenic
1165534816 19:36434880-36434902 CCACCACACCTGGCTAATTTTGG - Intergenic
1165565656 19:36725353-36725375 CCACCACACCCGGCTAATTTTGG + Intronic
1165593333 19:36989705-36989727 CCACCTTGTCCGGCTAATTTTGG + Intronic
1165612154 19:37164823-37164845 CCACCACACTCAGTTAATTTTGG + Intronic
1165728410 19:38128742-38128764 CCACCACACCCAGCTAATTTTGG - Intronic
1165781871 19:38439484-38439506 CCACCGCACCCGGCTATTTTTGG + Intronic
1165882757 19:39055150-39055172 CCACCACACCTGGCTAATTTTGG - Intergenic
1165949185 19:39464134-39464156 CCACCACACCCGGCTAATCTTGG + Intronic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166155943 19:40911069-40911091 CCACCATGCCCAGCTAATTTTGG + Intergenic
1166342294 19:42145779-42145801 CCACCATGCCCAGCTAATTTTGG - Intronic
1166537949 19:43587175-43587197 CCACCATGCCTGGCTAATTTTGG - Exonic
1166569752 19:43786447-43786469 CCACCACACCAGGCTAATTTTGG + Intergenic
1166729179 19:45048831-45048853 CCACCACGCTTGGCTAATTTTGG - Intronic
1166759721 19:45217172-45217194 CCACCACACCCGGATAATTTTGG + Intronic
1167317008 19:48770089-48770111 CCACCATACTGGGCTACTTTCGG - Intergenic
1167342830 19:48926029-48926051 CCACCACGCCCGGCTAATTTTGG - Intergenic
1167357517 19:49013114-49013136 CCACCATGCCCAGCTAATTTTGG + Intronic
1167573085 19:50302428-50302450 CCACCACACCCAGCTAATTTTGG - Intronic
1167721539 19:51183428-51183450 CCACCATGTCCGGCTAATTTTGG + Intergenic
1167876638 19:52419527-52419549 CCACCACACCCAGCTAATTTTGG + Intergenic
1167885340 19:52495317-52495339 CCACCATGCCCCGCTAATTTTGG + Intronic
1167890906 19:52538495-52538517 CCACCATGCCCTGCTAATTTTGG + Intronic
1167899134 19:52605296-52605318 CCACCACACCCGGCTACTTTTGG - Intronic
1168015553 19:53570101-53570123 CCACCATAGCCTGCTAATTTTGG - Intronic
1168098137 19:54126965-54126987 CCACCACACCCGGCTAATTTTGG - Intronic
1168259189 19:55183569-55183591 CCACCCCGCCTGGCTAATTTTGG - Intronic
1168385076 19:55956394-55956416 CCACTGCACCCGGCTAATTTTGG + Intronic
1168418394 19:56184106-56184128 CCACCACATCCGGCTAATTTTGG + Intronic
1168543077 19:57229108-57229130 CCACCACGCCCGGCTAATTTTGG - Intergenic
925263023 2:2544436-2544458 CCACCAGGCTCAGCTAATTTTGG - Intergenic
926105720 2:10149279-10149301 CCACCATGCCCGGCTAATTTTGG + Intronic
927685936 2:25170405-25170427 CCACCATGCCCAGCTAATTTTGG + Intergenic
927817184 2:26228965-26228987 CCACCATGCACGGCTATTTTTGG + Intronic
928028559 2:27759456-27759478 CCACCATGCCCGGCTAGTTTTGG + Intergenic
928124979 2:28609066-28609088 CCACCATGCCCAGCTAATTTTGG + Intronic
928421815 2:31142968-31142990 CCACCATGCCCGGCTAATTTTGG - Intronic
928563486 2:32517186-32517208 TCACCATGCCCGGCTAATTTTGG - Intronic
928581317 2:32710580-32710602 CCACCACACCTGGCTAATTTTGG + Intronic
929236519 2:39610824-39610846 CCACCATGCCTGGCTAATTTTGG + Intergenic
929347641 2:40906036-40906058 CCACCATGCCCGGCTAACTTTGG + Intergenic
929506416 2:42531603-42531625 CCACCACACCCAGCTAATTTTGG + Intronic
929674950 2:43917191-43917213 CCAACATGCCCGGCTAATTTTGG + Intronic
929968556 2:46553730-46553752 CCACCATGCCCAGCTAATTTTGG + Intronic
930040018 2:47114918-47114940 CCACCATGCCCAGCTAATTTTGG + Intronic
930333944 2:50022001-50022023 CCACCATGCCTGGCTAATTTTGG + Intronic
930664633 2:54089991-54090013 CCACCATGCCCTGCTAATTTTGG - Intronic
930666250 2:54101514-54101536 CCACCATACCCAGCTAATTTTGG - Intronic
930789226 2:55306727-55306749 CCACCACACTGGGCTAATTTTGG + Intronic
931232819 2:60388822-60388844 CCACCATGCCCGGCAAATTTTGG - Intergenic
931270199 2:60694936-60694958 CCACCACACCCAGCTAATTTTGG + Intergenic
931353883 2:61517054-61517076 CCACCACACTCAGCTAATTTTGG + Intronic
931399617 2:61919162-61919184 CCACCATGCCCAGCTAATTTTGG + Intronic
931431023 2:62209132-62209154 CCACCATACCCGGCTAATTTCGG + Intronic
931995029 2:67831564-67831586 CCACCATGCCAGGCTAATTTTGG + Intergenic
932184501 2:69681515-69681537 CCACCATATCCAGCTAATTTTGG + Intronic
932249961 2:70234712-70234734 CCACCATGTCCGGCTAATTTTGG + Intronic
932790452 2:74650260-74650282 CCACCATGCCCGGCTAATTTTGG - Intergenic
933653978 2:84872354-84872376 CCACCATGCCCGACTAATTTTGG - Intronic
933689286 2:85167049-85167071 CCACCACACCCGGCTAATTTTGG + Intronic
933720804 2:85396336-85396358 CCACCACACTCAGCTAATTTTGG + Intronic
933732115 2:85464936-85464958 CCACCATGCCCGGCTAATTTGGG + Intergenic
934866070 2:97812849-97812871 CCACCATGCCCAGCTAATTTTGG - Intronic
935389513 2:102535814-102535836 CCACCACACCCGGCTAATTTTGG + Intergenic
935657144 2:105433331-105433353 CCACCATGCCCAGCTAATTTTGG + Intronic
935728361 2:106043754-106043776 CCACCGCACCCTGCTAATTTTGG - Intergenic
937958754 2:127438610-127438632 CCACCCGACTCGTCCAATCTAGG - Intronic
938227046 2:129625297-129625319 CCACCATACCCTGCTAATTTTGG + Intergenic
938529813 2:132173444-132173466 CCACCACGCCCGGCTAATTTTGG + Intronic
938793916 2:134702490-134702512 CCACCATGCCCGGCTAATTTTGG - Intronic
938821018 2:134960320-134960342 CCACCATGCCCGGCTAATTTTGG + Intergenic
938835362 2:135097366-135097388 CCACCATGCCCGGCTAAGTTGGG + Intronic
939034416 2:137113587-137113609 CCACCACATCCGGCTAATTTGGG + Intronic
939181255 2:138804745-138804767 CCACCATGCCTGGCTAATTTTGG - Intergenic
939364137 2:141211138-141211160 CTACCATGCTCAGCTAATTTTGG + Intronic
939433767 2:142146458-142146480 CCACCGTGCCCGGCTAATTCTGG - Intergenic
939521268 2:143233795-143233817 CCACCAAGCCCGGCTAATTTTGG + Intronic
939611393 2:144315036-144315058 CCACCATCCCCGGCTAATTTTGG + Intronic
939918565 2:148079702-148079724 CCACCATGCCTGGCTAATTTTGG - Intronic
940785244 2:157974084-157974106 CCACCATGCCTGGCTAATTTTGG + Intronic
941223596 2:162816102-162816124 CCACCACAACCGGCTAATTTTGG - Intronic
941695105 2:168542847-168542869 CCACCACACCTGGCTAATTTTGG + Intronic
941783872 2:169477938-169477960 CCACCGTGCCCAGCTAATTTGGG + Intergenic
941872676 2:170401953-170401975 CCACCACGCCCGGCTAATTTAGG + Intronic
941923970 2:170877903-170877925 CCACCATACCCAGGTAATTTTGG + Intergenic
942217131 2:173732454-173732476 CCACCACACCTGGCTAATTTTGG + Intergenic
942350364 2:175046262-175046284 TCACCATGCTCGGCTAATGTTGG + Intergenic
942392587 2:175511199-175511221 CCACCATGCCCTGCTAATTTGGG - Intergenic
942753132 2:179310301-179310323 CCACCATACCCAGCTAATTTTGG - Intergenic
943352978 2:186817297-186817319 CCACCATGCCCAGCTAATTTTGG - Intergenic
944082961 2:195810562-195810584 CCACCATGCCTGGCTAATTTTGG + Intronic
944093180 2:195936219-195936241 CCACCATGCCCAGCTAATTTTGG - Intronic
944316491 2:198290757-198290779 CCACCATGCTCGGCTAAATTTGG - Intronic
944497920 2:200327249-200327271 CCACCACACTGGGCTAATTTTGG - Intronic
944544263 2:200783740-200783762 CCACCATGCCCAGCTAATTTTGG + Intergenic
944753963 2:202740205-202740227 CCACCACACTCGGCTAATTTGGG - Intronic
945222429 2:207498597-207498619 CCAGCCTCCTCCTCTAATTTAGG - Intergenic
945285829 2:208080507-208080529 CCACCATGCTCGGCCTATTTTGG - Intergenic
945457991 2:210071003-210071025 CCACCACACCCGGCTAATTTTGG - Intronic
945902972 2:215559235-215559257 CCACCACGCCCGGCTAATTTTGG + Intergenic
946046891 2:216828793-216828815 TCACACTACTCGGAAAATTTAGG - Intergenic
946270771 2:218591588-218591610 CCACCATGCCTGGCTAATTTTGG - Intronic
946283162 2:218681277-218681299 CCACCACACGTGGCTAATTTTGG + Intronic
946424950 2:219589396-219589418 CCACCACACCCGGCTAATTTTGG - Intergenic
946749461 2:222879163-222879185 CCACCATGCCCGGCTAATTTTGG - Intronic
946848160 2:223879504-223879526 CCACCAGGCTTGGCTAATTTTGG - Intronic
946945351 2:224815881-224815903 CCACCACACCTGGCTAATTTTGG - Intronic
947016981 2:225631968-225631990 CCACCATGCCTGGCTAATTTTGG + Intronic
947557012 2:231101966-231101988 CCACCATGCCTGGCTAATTTTGG + Intronic
947695656 2:232185695-232185717 CCACCACACTCAGCTAATTTTGG - Intronic
947770818 2:232668784-232668806 CCACCATGCCCGGCTAATTTTGG + Intronic
948139529 2:235662133-235662155 CCACCCTACTCAGCTCCTTTAGG + Intronic
948968699 2:241406597-241406619 CCACCATATCTGGCTAATTTGGG + Intronic
1169165132 20:3416135-3416157 CCACCATGCCCAGCTAATTTTGG + Intergenic
1169246189 20:4027078-4027100 CCACCATGCCTGGCTAATTTTGG + Intergenic
1169248847 20:4045122-4045144 CCAGCCTACTCTGCAGATTTTGG - Intergenic
1169252322 20:4070072-4070094 CCAGCCTACTCTGCAAATTTTGG - Intergenic
1169264452 20:4159262-4159284 CCACCACGCCCGGCTAATTTTGG + Intronic
1169338523 20:4777218-4777240 CCACCATGCCCAGCTAATTTTGG + Intergenic
1169380789 20:5105436-5105458 CCACCGCACCCGGCTAATGTTGG - Intronic
1169579862 20:7008727-7008749 CCACCATGCCCAGCTAATTTTGG + Intergenic
1169747504 20:8957670-8957692 CCACCACACTCGGCTAATTTTGG + Intronic
1169776381 20:9258560-9258582 CCACCACACCCGGCTAATTTTGG - Intronic
1170224432 20:13976152-13976174 CCACCACACCCAGCTAATTTTGG + Intronic
1170683563 20:18548102-18548124 CCACCACACCCGGGTAATTTTGG + Intronic
1171537573 20:25909351-25909373 CCACCACGCCCGGCTAATTTTGG - Intergenic
1171814693 20:29775320-29775342 CCACCATGCCTGGCTAATTTTGG + Intergenic
1171945675 20:31375300-31375322 CCACCATGCCTGGCTAATTTTGG + Intergenic
1172071247 20:32258911-32258933 CCACCGCACTCAGCTAATTTTGG - Intergenic
1172076394 20:32301238-32301260 CCACCACACCCAGCTAATTTTGG + Intronic
1172160142 20:32862281-32862303 CCACCACACCTGGCTAATTTTGG + Intronic
1172597750 20:36161911-36161933 CCACCATGCCCGGCTAATTTGGG + Intronic
1172641798 20:36444791-36444813 CCACCACGCTCGGCCAATTTTGG + Intronic
1172761639 20:37327542-37327564 CCACCGTACCTGGCTAATTTTGG - Intergenic
1172830506 20:37829982-37830004 CCACCATGCCCAGCTAATTTTGG + Intronic
1173608195 20:44346987-44347009 CCACCATGCCCAGCTAATTTTGG - Intronic
1174009810 20:47440511-47440533 CCACCACACCCAGCTAATTTTGG - Intergenic
1174048744 20:47752596-47752618 CCATCACACTCAGCTAATTTTGG - Intronic
1174078426 20:47954272-47954294 CCACCATGCCCAGCTAATTTGGG + Intergenic
1174347454 20:49940892-49940914 CCACCATGCCTGGCTAATTTTGG + Intronic
1174384665 20:50180027-50180049 CCACCATACCTGGCTAATTTTGG + Intergenic
1174435142 20:50501043-50501065 CCACCACGCCCGGCTAATTTTGG - Intergenic
1174583974 20:51593122-51593144 CCACCACACCTGGCTAATTTTGG - Intergenic
1174604835 20:51753817-51753839 CCACCATGCCCAGCTAATTTTGG + Intronic
1174621552 20:51878728-51878750 CCACCACGCCCGGCTAATTTTGG + Intergenic
1174836360 20:53859289-53859311 TCACCATGCCCGGCTAATTTTGG + Intergenic
1174838457 20:53879590-53879612 CCACCACACCCAGCTAATTTTGG - Intergenic
1174840195 20:53894071-53894093 CCACCACGCCCGGCTAATTTTGG - Intergenic
1175878288 20:62241343-62241365 CCACCACACCTGGCTAATTTTGG + Intronic
1176211782 20:63927381-63927403 CCACCACACCCAGCTAATTTTGG - Intronic
1176277592 20:64281368-64281390 CCACCACTCCCGGCTAATTTTGG + Intronic
1176423042 21:6531701-6531723 CCACCTTTCCTGGCTAATTTGGG - Intergenic
1176580993 21:8525444-8525466 CCTCCCTACTCTGATTATTTAGG - Intergenic
1176700035 21:10035142-10035164 CCACCAAACTCAGATAATTTTGG + Intergenic
1176718816 21:10377223-10377245 CCACCATGCCTGGCTAATTTTGG + Intergenic
1176766692 21:13026490-13026512 CCACCATGGCCGGCTAATTTTGG - Intergenic
1177221929 21:18205887-18205909 CCACCATGCCTGGCTAATTTAGG + Intronic
1177641663 21:23851102-23851124 CCACCCCACCCAGCTAATTTTGG - Intergenic
1177706761 21:24715661-24715683 CCACCACACTCAGCTACTTTTGG - Intergenic
1177789122 21:25703002-25703024 CCACCGCACCCAGCTAATTTTGG + Intronic
1178361822 21:31954933-31954955 CCACCATGCCTGGCTAATTTTGG + Intronic
1178433672 21:32538214-32538236 CCACCATGCTCAACTAATTTTGG - Intergenic
1178711471 21:34921009-34921031 CCACCATGCCCAGCTAATTTTGG + Intronic
1178765356 21:35445793-35445815 CCACCATGCCCAGCTAATTTTGG + Intronic
1178865387 21:36322522-36322544 CCACCACACCCGGCTAATTTTGG + Intronic
1179027361 21:37690932-37690954 CCACCATACCCGGCTAAGTTTGG + Intronic
1179475937 21:41644492-41644514 CCAGCATGCCCGGCTAATTTTGG + Intergenic
1179698536 21:43140017-43140039 CCACCTTTCCTGGCTAATTTGGG - Intergenic
1180431259 22:15252834-15252856 CCACCACGCCCGGCTAATTTTGG - Intergenic
1180894091 22:19315295-19315317 CCACCATGCCCAGCTAATTTTGG - Intergenic
1181154854 22:20913332-20913354 CCACCATGCTCAGCTAATTTTGG + Intergenic
1182229638 22:28827748-28827770 CCACCACACTCAGCTAATTTTGG + Intergenic
1182247964 22:28975347-28975369 CCACCACTCCCGGCTAATTTTGG - Intronic
1182592274 22:31390689-31390711 CCACTGTGCTCGGCTAATTTTGG + Intergenic
1182840975 22:33389690-33389712 CCACCATGCCCGGCTCATTTTGG - Intronic
1182955374 22:34419399-34419421 CCACCACACCTGGCTAATTTTGG + Intergenic
1183207541 22:36430037-36430059 CCACCACACCCAGCTAATTTTGG + Intergenic
1183559230 22:38557551-38557573 CCAGCATACCTGGCTAATTTTGG - Intronic
1183696064 22:39423123-39423145 CCACCACACCTGGCTAATTTTGG + Intronic
1184017453 22:41796792-41796814 CCACCACACCCAGCTAATTTTGG - Intronic
1184166636 22:42733020-42733042 CCACCACACTCAGCTAATTTTGG - Intergenic
1184365335 22:44047506-44047528 CCACCATGCCCGGCTAATTTTGG - Intronic
1184580274 22:45412657-45412679 CCACCACACCCAGCTAATTTTGG + Intronic
1184938987 22:47747063-47747085 CCACCACATTCGGCTAATTTTGG - Intergenic
949276356 3:2287447-2287469 CCACCATGCCCTGCTAATTTTGG - Intronic
949314548 3:2737231-2737253 CCACCATGCCCAGCTAATTTTGG + Intronic
949348833 3:3103025-3103047 CCACCATGCTGGGCTAATGTGGG + Intronic
949549552 3:5100955-5100977 CCACCACACCCAGCTAATTTTGG - Intergenic
950900092 3:16489753-16489775 CCACTACACACGGCTAATTTTGG - Intronic
951516446 3:23565265-23565287 CCTCCCTATTTGGCTAATTCCGG - Intronic
951688168 3:25367671-25367693 CCCCCATATGCGGCTAATTTTGG - Intronic
951927062 3:27919821-27919843 CCACCATGCCTGGCTAATTTTGG - Intergenic
952390536 3:32875679-32875701 ACACCACACCCGGCTAATTTTGG - Intronic
952423963 3:33156191-33156213 CCACCACACCCAGCTAATTTTGG + Intronic
953355282 3:42251123-42251145 CCACCATGCCCAGCTAATTTTGG + Intergenic
953402848 3:42641426-42641448 CCACCCTTCTCCCCTACTTTAGG - Intronic
953423323 3:42772117-42772139 CCACCATGCCTGGCTAATTTTGG - Intronic
953742710 3:45551364-45551386 CCACCACACCCAGCTAATTTAGG + Intergenic
954103496 3:48396316-48396338 CCACCATGCCCGGCTAATTTTGG - Intronic
954337410 3:49927746-49927768 CCACCATACCTGGCTAATTAAGG - Intronic
954778296 3:53039785-53039807 CCACCACACCTGGCTAATTTTGG + Intronic
954778454 3:53041543-53041565 CCACCATTCCTGGCTAATTTTGG - Intronic
955379694 3:58427472-58427494 CCACCACATCCGGCTAATTTTGG - Intergenic
956078343 3:65530459-65530481 CCACCACACCCGGGTAATTTTGG - Intronic
956476768 3:69630425-69630447 CCACCATGCCCAGCTAATTTAGG - Intergenic
956636388 3:71369545-71369567 CCACCATGCCCAGCTAATTTTGG + Intronic
957166654 3:76682558-76682580 CCACCATGCCCAGCTAATTTTGG + Intronic
957546898 3:81650815-81650837 CCACCATGCTCAGCTAATTTTGG + Intronic
957782591 3:84838427-84838449 CCACCACACCTGGCTAATTTTGG + Intergenic
958037841 3:88190883-88190905 CCACCACACCCAGCTAATTTTGG - Intergenic
958792163 3:98664311-98664333 CCACCATACCTGGCTAATTTGGG + Intergenic
959072991 3:101720501-101720523 CCACCACACCTGGCTAATTTTGG - Intergenic
959638977 3:108609686-108609708 CCACCACACCCAGCTAATTTTGG - Intronic
959687008 3:109158547-109158569 CCACCACACCCGGCTAATTTTGG + Intergenic
959983191 3:112541232-112541254 CCACCACACCCAGCTAATTTTGG - Intronic
960103276 3:113767242-113767264 CCGCCATGCCCGGCTAATTTTGG + Intronic
960625976 3:119682548-119682570 CCACCATGCCCAGCTAATTTTGG - Intergenic
960662364 3:120074502-120074524 CCACCACACCCGGCTAATTTTGG + Intronic
960780076 3:121310754-121310776 CCACCATGCCTGGCTAATTTTGG - Intronic
961247408 3:125467232-125467254 CCACCACACCCGGCTAATTTTGG - Intronic
961587452 3:127945031-127945053 CCAACCCACCCAGCTAATTTTGG + Intronic
961708707 3:128810099-128810121 CCACCATGCCCAGCTAATTTTGG + Intronic
961739394 3:129023479-129023501 CCACCATGCCTGGCTAATTTTGG + Intronic
961786578 3:129350820-129350842 CCACCATGCCCGGCTAATTTTGG - Intergenic
961844979 3:129754923-129754945 CCACCACACCTGGCTAATTTTGG - Intronic
961899657 3:130198236-130198258 CCACCACACGTGGCTAATTTTGG - Intergenic
962243308 3:133769726-133769748 CCAACCCACTCGGCTCATTGAGG + Intronic
962601307 3:136992852-136992874 CCACCATGCTCAGCTCATTTAGG + Intronic
963012014 3:140779036-140779058 CCAACCTTCTCTTCTAATTTTGG - Intergenic
963198908 3:142566894-142566916 CCACCACACCCAGCTAATTTTGG + Intronic
963201736 3:142593110-142593132 CCACCACACCTGGCTAATTTTGG + Intergenic
963461438 3:145619014-145619036 CCACCACGCCCGGCTAATTTTGG - Intergenic
964124728 3:153224251-153224273 CCACCATGCCTGGCTAATTTTGG + Intergenic
964387869 3:156168048-156168070 CCACCATAGATGGCTAATTTTGG - Intronic
964466148 3:156995677-156995699 CCCCCATGCCCGGCTAATTTTGG - Intronic
964738840 3:159944343-159944365 CCACCATACCCAGCTAATTTTGG + Intergenic
964868622 3:161289208-161289230 CCACCACACTTGGCTACTTTGGG + Intergenic
965339118 3:167464164-167464186 CCACCATGCCCAGCTAATTTTGG + Intronic
965489730 3:169321385-169321407 CCACCATGCCCAGCTAATTTTGG - Intronic
965583941 3:170298556-170298578 CCACCACACCTGGCTAATTTCGG + Intronic
966166988 3:177030957-177030979 CCACCACACCCGGCTAGTTTTGG - Intronic
966173582 3:177111423-177111445 CCACCATGCCAGGCTAATTTGGG + Intronic
966219909 3:177541149-177541171 CCACCACACCCAGCTAATTTAGG + Intergenic
966412040 3:179654059-179654081 CCACCGCGCCCGGCTAATTTTGG - Intronic
966590383 3:181675470-181675492 CCACCACGCCCGGCTAATTTTGG - Intergenic
966601220 3:181777035-181777057 CCACCACACCCAGCTAATTTTGG + Intergenic
966823292 3:183942190-183942212 CCACCACACCTGGCTAATTTTGG + Intronic
967051486 3:185788862-185788884 CCACCACACCCAGCTAATTTTGG + Intronic
967732951 3:192923017-192923039 CCACCACACCCGGCTAATTTTGG + Intergenic
967925093 3:194639747-194639769 ACACCATGCCCGGCTAATTTTGG + Intergenic
968017636 3:195352926-195352948 CCACCACACCCAGCTAATTTTGG - Intronic
968024025 3:195423468-195423490 CCATCACACCCGGCTAATTTTGG - Intronic
968112620 3:196061640-196061662 CCACCACACCCGGCTAATTTTGG + Intronic
968825598 4:2894403-2894425 CCACCATGCCCAGCTAATTTTGG - Intronic
969010320 4:4056391-4056413 CCACCACACCTGGCTAATTTTGG - Intergenic
969035776 4:4252463-4252485 CCACCATGCCCGGCTAATTTCGG + Intergenic
969040528 4:4291983-4292005 CCACCACACCCGCCTAATTTTGG - Intronic
969043371 4:4318461-4318483 CCACCATGCCCAGCTAATTTTGG - Intronic
969132628 4:5002932-5002954 CCACCATACCCGGCTAATTTTGG - Intergenic
969217347 4:5732855-5732877 CCACCATACCCGGTTGATTTTGG - Intronic
969358341 4:6645026-6645048 CCACCATGCCCTGCTAATTTTGG + Intergenic
969420622 4:7092833-7092855 CCACCATGCCTGGCTAATTTTGG + Intergenic
969743731 4:9053502-9053524 CCACCACACCTGGCTAATTTTGG + Intergenic
970452559 4:16185519-16185541 CCACCACACCCAGCTAATTTTGG + Intronic
971045487 4:22801116-22801138 CCACCATGCCTGGCTAATTTTGG + Intergenic
971344106 4:25796639-25796661 CCACCATGCCTGGCTAATTTTGG - Intronic
972446658 4:39150714-39150736 CCACCACGCCCGGCTAATTTTGG - Intergenic
972542036 4:40047722-40047744 CCACCACACCCAGCTAATTTTGG - Intergenic
973030222 4:45328559-45328581 CCACACTCTTCGGATAATTTTGG + Intergenic
973177425 4:47225045-47225067 CCACCATACCGGGCTAATTTTGG + Intronic
973318510 4:48786006-48786028 CCACCATGCCCGGCTAATTTTGG + Intergenic
973556208 4:52085754-52085776 CCACCATGCCTGGCTAATTTGGG - Intronic
973614740 4:52667095-52667117 CCACCCTACTTGGCTAACTTAGG - Intergenic
973978498 4:56286238-56286260 CCACCACACTCGTCTAATTTTGG - Intronic
974006941 4:56567417-56567439 CCACCACACCTGGCTAATTTTGG + Intronic
974008923 4:56589139-56589161 CCACCACACCTGGCTAATTTTGG + Intronic
974051017 4:56942244-56942266 CCACCACACCTGGCTAATTTTGG - Intergenic
974443756 4:61952324-61952346 CCACCACACCTGGCTAATTTTGG - Intronic
974445377 4:61974118-61974140 CCACCCTGTCCAGCTAATTTTGG + Intronic
974731470 4:65872169-65872191 CCACCATGCCCGGCTAATTTTGG - Intergenic
974892506 4:67898782-67898804 CCACCACACCTGGCTAATTTTGG - Intergenic
975408698 4:74022668-74022690 CCACCATGCTCAGCTAATTTTGG + Intergenic
975566417 4:75760057-75760079 CCACCACGCCCGGCTAATTTTGG - Intronic
975624991 4:76337131-76337153 CCACCACACCCGGCTATTTTTGG + Intronic
976258365 4:83122246-83122268 CCACCATGCCTGGCTAATTTTGG + Intronic
976374785 4:84333028-84333050 CCACCATACTCAGCTAATTTTGG + Intergenic
976567701 4:86570729-86570751 CCATTCTACTAAGCTAATTTAGG - Intronic
976765044 4:88591040-88591062 CCACCCTACTCGGCTAATTTTGG + Intronic
976800759 4:88989053-88989075 CCATCATGCCCGGCTAATTTTGG - Intronic
977216032 4:94284548-94284570 CCACCACACCCAGCTAATTTTGG + Intronic
977297313 4:95225207-95225229 CCACCATGTCCGGCTAATTTTGG + Intronic
977864131 4:102002924-102002946 CCACCATGCCCAGCTAATTTTGG + Intronic
977879449 4:102187307-102187329 CCACCATACCCAGCTAATTTTGG - Intergenic
978363421 4:107955168-107955190 CCACCATGCCCAGCTAATTTTGG - Intergenic
978433004 4:108653057-108653079 CCACCAGGCTCAGCTAATTTTGG - Intronic
978496057 4:109360246-109360268 CCACCATGCCCGGCTAATTTTGG - Intergenic
978540293 4:109809457-109809479 CCACCAAGCCCGGCTAATTTTGG + Intergenic
978557623 4:109997708-109997730 CCACCATACCTGGCTAACTTTGG - Intronic
978675614 4:111311125-111311147 CCACCATGACCGGCTAATTTTGG - Intergenic
979248229 4:118534166-118534188 CCACCACGCCCGGCTAATTTTGG - Intergenic
979316110 4:119265516-119265538 CCACCACACCTGGCTAATTTTGG - Intronic
979519071 4:121645265-121645287 CCACCATACCTGGATAATTTTGG - Intergenic
979580436 4:122352510-122352532 CCACCGCACCCAGCTAATTTTGG + Intronic
979622030 4:122808888-122808910 CCATCGTGCCCGGCTAATTTTGG - Intergenic
979681013 4:123459623-123459645 CCACCACACCCAGCTAATTTTGG - Intergenic
979697518 4:123630410-123630432 CCACCACACCCAGCTAATTTTGG + Intergenic
980022270 4:127723815-127723837 CTACCACACCCGGCTAATTTTGG - Exonic
980061750 4:128137939-128137961 CCACCAAACCTGGCTAATTTTGG + Intronic
980372436 4:131893769-131893791 CCACCAAACTCAGATAATTTTGG + Intergenic
981142305 4:141282799-141282821 CCACCACGCCCGGCTAATTTTGG - Intergenic
981330054 4:143497905-143497927 CCACTATACCCAGCTAATTTTGG - Intergenic
981485115 4:145277743-145277765 CCACCATGCCCGGCTAACTTTGG + Intergenic
982003278 4:151040735-151040757 CCACCACACTTGGCTTATTTTGG - Intergenic
982543408 4:156704642-156704664 CCACCATGCCTGGCTAATTTGGG - Intergenic
982574068 4:157086124-157086146 CAAGCCTACTCGCCTATTTTGGG + Intronic
982952427 4:161716442-161716464 CCACCAAACTCGGCTCACTTTGG - Intronic
983203260 4:164885281-164885303 CCACCACACTCAGCTAATTTGGG + Intronic
983527950 4:168780049-168780071 CCACCATGCCCGACTAATTTTGG + Intronic
983551892 4:169026114-169026136 CCACCACACCCAGCTAATTTTGG - Intergenic
983587123 4:169367806-169367828 CCACCACGCTCAGCTAATTTTGG - Intergenic
983977567 4:173953848-173953870 CCACCACGCCCGGCTAATTTTGG + Intergenic
984138697 4:175974833-175974855 CCACCATGCCCAGCTAATTTTGG + Intronic
984309029 4:178032967-178032989 CCATCCTACTTGTCGAATTTTGG + Intergenic
984652147 4:182281886-182281908 CCACCATACCCGGCTAATTTTGG + Intronic
984794260 4:183643763-183643785 CCACCACACCTGGCTAATTTTGG - Intronic
985000007 4:185472973-185472995 CCACCATACCTGGCTAATTTTGG - Intergenic
985225859 4:187761278-187761300 CCACCACACCCAGCTAATTTTGG - Intergenic
985372746 4:189303369-189303391 CCACCACACCCGGCTAATTTCGG + Intergenic
985768100 5:1791728-1791750 CCGCCATGCCCGGCTAATTTTGG + Intergenic
985791168 5:1927719-1927741 CCACTGCACTCGGCTCATTTAGG + Intergenic
986723492 5:10577280-10577302 CCACCATGCCTGGCTAATTTTGG + Intronic
987186788 5:15429620-15429642 CCAACCTACCCTGCTGATTTTGG - Intergenic
987955128 5:24729200-24729222 CCACCACGCCCGGCTAATTTTGG - Intergenic
987980146 5:25073665-25073687 CCACCGCACCCGGCTAATTTTGG + Intergenic
988036647 5:25835493-25835515 CCACCATACCTGGCTAATTTTGG + Intergenic
988207697 5:28161354-28161376 CCACCACACCAGGCTAATTTTGG - Intergenic
988366569 5:30308358-30308380 CCACCGTGCTCAGCTATTTTTGG + Intergenic
988462321 5:31451047-31451069 CCACCATGCCTGGCTAATTTTGG - Intronic
988593739 5:32571864-32571886 CCACCATGCCCAGCTAATTTTGG - Intronic
988598363 5:32616356-32616378 CCACCATGCCTGGCTAATTTTGG + Intergenic
988838089 5:35053498-35053520 CCACCACACCCAGCTAATTTTGG - Intronic
989030074 5:37109807-37109829 CCACCATGCCCAGCTAATTTTGG + Intronic
989309461 5:39997719-39997741 CCACCATGCCTGGCTAATTTTGG - Intergenic
989413820 5:41150732-41150754 CCACCATGCCCTGCTAATTTTGG - Intronic
989521216 5:42402970-42402992 CCACCATGCATGGCTAATTTTGG - Intergenic
990246996 5:53873170-53873192 CCACCATGCCTGGCTAATTTTGG + Intergenic
990428293 5:55710766-55710788 CCACCACACCTGGCTAATTTTGG + Intronic
990471789 5:56122504-56122526 CCACCATGCCTGGCTAATTTTGG - Intronic
990570303 5:57071764-57071786 CCACCATGCCTGGCTAATTTTGG + Intergenic
991771318 5:70043615-70043637 CCACCACACCTGGCTAATTTTGG - Intergenic
991850610 5:70919032-70919054 CCACCACACCTGGCTAATTTTGG - Intergenic
991953572 5:71970489-71970511 CCACCATGCCTGGCTAATTTTGG + Intergenic
992042946 5:72855146-72855168 CCACCATGCCTGGCTAATTTGGG + Intronic
992212839 5:74497290-74497312 CCACCACACCCGGCTAATTTTGG - Intergenic
992255237 5:74914587-74914609 CCACCCTACTCCCCTAAATCAGG - Intergenic
992333530 5:75741916-75741938 CCACCATGCCCAGCTAATTTTGG + Intergenic
993631092 5:90286790-90286812 CCACCACACCTGGCTAATTTTGG - Intergenic
993948938 5:94149902-94149924 CCACCATGCCTGGCTAATTTTGG + Intergenic
994331530 5:98512019-98512041 CCCCCACACCCGGCTAATTTTGG - Intergenic
994340253 5:98618398-98618420 CCACCACGCCCGGCTAATTTTGG + Intergenic
994782736 5:104113303-104113325 CCACCATGCCCAGCTAATTTTGG + Intergenic
995329302 5:110929358-110929380 CCACCATGCCCAGCTAATTTTGG + Intergenic
995437096 5:112148843-112148865 CCTCCCTCCTCTGCTGATTTGGG + Intronic
995933437 5:117480374-117480396 CCACCACGCCCGGCTAATTTTGG - Intergenic
996366649 5:122708615-122708637 CCACCATGCCCAGCTAATTTTGG + Intergenic
996948900 5:129101341-129101363 CCACTGCACCCGGCTAATTTTGG - Intronic
997462388 5:134062137-134062159 CCACCATGCCCGGCTAATTTTGG + Intergenic
997473481 5:134129676-134129698 CCACGCCACTCGGCTAAGTGGGG + Intronic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
997768949 5:136534949-136534971 CCACCATGCCCGGCTAATTTTGG + Intergenic
997992129 5:138553283-138553305 CCACCACACCCAGCTAATTTTGG - Intergenic
998469031 5:142368964-142368986 CCACCATGCCTGGCTAATTTTGG + Intergenic
998497366 5:142602327-142602349 CCACCATGCCCGGCTAATTTTGG + Intronic
998810878 5:145964592-145964614 CCACCATGCTCGGCCAGTTTTGG + Intronic
999057170 5:148590447-148590469 CCACCATGCTTGGCTAATTTTGG + Intronic
999583134 5:153062039-153062061 CCACCACACCCAGCTAATTTTGG + Intergenic
999958522 5:156728357-156728379 CCACCACACTCGGCTAGTTTTGG - Intronic
1000337071 5:160249608-160249630 TCACCATACCCAGCTAATTTTGG - Intergenic
1000552604 5:162685468-162685490 CCACGATACCCAGCTAATTTTGG + Intergenic
1000750331 5:165087420-165087442 CCACCATGCCCAGCTAATTTTGG + Intergenic
1000892472 5:166816011-166816033 TCACCATGCCCGGCTAATTTTGG - Intergenic
1000944021 5:167398590-167398612 CCACCATGCCCAGCTAATTTTGG + Intronic
1001008542 5:168076376-168076398 CCACCACACCCGACTAATTTTGG + Intronic
1001011621 5:168104180-168104202 CCACCACACCCAGCTAATTTTGG + Intronic
1001470802 5:172011298-172011320 CCACCACACCCAGCTAATTTTGG + Intergenic
1001583234 5:172814407-172814429 CCACCATGCTCGGCTAATTTTGG - Intergenic
1001592087 5:172872660-172872682 CCACCACACCAGGCTAATTTTGG - Intronic
1001622425 5:173099306-173099328 CCCCCATACCCAGCTAATTTTGG + Intronic
1001995104 5:176151133-176151155 CCACCATGCCTGGCTAATTTGGG + Intergenic
1002035124 5:176462469-176462491 CCACCACGCCCGGCTAATTTTGG - Intronic
1002481993 5:179507719-179507741 CCACCATGCCCGGCTAGTTTTGG - Intergenic
1002568111 5:180124978-180125000 CCTCCATACCTGGCTAATTTTGG - Intronic
1002623717 5:180509282-180509304 CCACCACACTTGGTTAATTTTGG + Intronic
1003352467 6:5330951-5330973 CCACCGCACCTGGCTAATTTTGG - Intronic
1003583646 6:7366091-7366113 CCACCATGCCCGGATAATTTTGG - Intronic
1003587559 6:7406811-7406833 CCACTACACCCGGCTAATTTGGG + Intronic
1003637866 6:7850293-7850315 CCACCATGCCTGGCTAATTTTGG + Intronic
1003699776 6:8448957-8448979 CCACCATGCCCGGCTAATTTTGG - Intergenic
1003918519 6:10809943-10809965 CCACCATGCCCGGCTAATTTTGG - Intronic
1004220516 6:13742902-13742924 CCACCACACCCGGCTAATTTTGG + Intergenic
1004366820 6:15019856-15019878 CCACCATGCCCAGCTAATTTTGG + Intergenic
1005047945 6:21660019-21660041 CCACCACACCCGGCTAATTTTGG + Intergenic
1005160671 6:22858921-22858943 CCACCATGCCCAGCTAATTTTGG + Intergenic
1005292227 6:24390999-24391021 CCACCACACTTGGCTAATTTTGG - Intergenic
1005302648 6:24485820-24485842 CCACCACGCCCGGCTAATTTTGG + Intronic
1005474018 6:26189607-26189629 CCACCATGCCCAGCTAATTTTGG + Intergenic
1005904155 6:30246348-30246370 CCACCACACCCAGCTAATTTCGG + Intergenic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006148762 6:31975352-31975374 CCACCATGCCCAGCTAATTTTGG + Intronic
1006216507 6:32448528-32448550 CCATCATACTTGGCTAAGTTTGG - Intergenic
1006325997 6:33354455-33354477 CCACCACACCCAGCTAATTTTGG + Intergenic
1006330609 6:33387901-33387923 CCACCATGCCCAGCTAATTTTGG - Intergenic
1006413013 6:33886216-33886238 CCACCACACCTGGCTAATTTTGG - Intergenic
1006612861 6:35305296-35305318 CCGCCACACCCGGCTAATTTTGG + Intronic
1006773005 6:36569415-36569437 CCACCATGCCCAGCTAATTTTGG + Intergenic
1006780450 6:36628859-36628881 CCACCACACCTGGCTAATTTTGG - Intergenic
1006866920 6:37216229-37216251 CCACTATACCCGCCTAATTTTGG + Intronic
1006881046 6:37340250-37340272 CCACCATGCTGGGCTAATTTAGG - Intergenic
1006957486 6:37886849-37886871 CCACCACACCTGGCTAATTTTGG - Intronic
1007455481 6:41974028-41974050 CCACCACACCCGGCTAATTTTGG - Intronic
1007516040 6:42412151-42412173 CCACCATGCCTGGCTAATTTTGG + Intronic
1009502011 6:64425499-64425521 CCACCACACCCGGCTAATTTTGG - Intronic
1010040223 6:71372951-71372973 CCACCATGCCCGGCTAATTTTGG - Intergenic
1010136950 6:72565933-72565955 CCACCACACCCAGCTAATTTTGG + Intergenic
1010687525 6:78869954-78869976 CCACCATGCTTGGCTAATTTTGG - Intronic
1011654327 6:89536075-89536097 CCACCATTCCCGGCTAATTTTGG - Intronic
1011691616 6:89875346-89875368 CCACCATGCCCAGCTAATTTTGG - Intergenic
1011778180 6:90755863-90755885 CCACCATGCCTGGCTAATTTTGG + Intergenic
1012145878 6:95681024-95681046 CCACCATGCCCAGCTAATTTTGG - Intergenic
1012230529 6:96755733-96755755 CCACCATGCCCGGCTAATTTTGG - Intergenic
1012444061 6:99290547-99290569 ACACCATGCCCGGCTAATTTTGG - Intronic
1012581049 6:100871246-100871268 CCACCACGCCCGGCTAATTTTGG + Intronic
1012888036 6:104867106-104867128 CCACCATGCCCAGCTAATTTTGG + Intergenic
1013122801 6:107156040-107156062 CCACCACACCTGGCTAATTTTGG + Intronic
1013331626 6:109107786-109107808 CCACCATGCCCAGCTAATTTTGG - Intronic
1013505146 6:110792558-110792580 CCACCACGCCCGGCTAATTTTGG + Intronic
1013515408 6:110880823-110880845 CCACCACACCTGGCTAATTTTGG + Intronic
1013695562 6:112698622-112698644 CCACCATGCCCAGCTAATTTTGG - Intergenic
1014636510 6:123853923-123853945 CCACCACACCCGGCTAATTTTGG + Intronic
1014914993 6:127135772-127135794 CCATCATGCCCGGCTAATTTTGG - Intronic
1015260294 6:131229499-131229521 CCACAGTACCTGGCTAATTTTGG + Intronic
1015345130 6:132147590-132147612 CCACTCTAGTCAGCTAACTTTGG - Intergenic
1015630593 6:135228416-135228438 CCACCATGCCCAGCTAATTTTGG + Intergenic
1015696849 6:135990246-135990268 CCACCACACCCAGCTAATTTTGG + Intronic
1016340228 6:143054268-143054290 CCACCACACTCGCTTAATTTTGG + Intergenic
1016470837 6:144372645-144372667 CCACCATGCCTGGCTAATTTTGG + Intronic
1016831888 6:148442252-148442274 CCACCACACCTGGCTAATTTTGG - Intronic
1017285225 6:152667307-152667329 CCACCATGCCCAGCTAATTTTGG - Intergenic
1017509587 6:155102147-155102169 CCACCATGCCTGGCTAATTTTGG + Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1018145859 6:160888052-160888074 CCACCATACCCAGCTAATTTTGG - Intergenic
1018282702 6:162205013-162205035 CCACCACACCCAGCTAATTTTGG + Intronic
1018550516 6:164992440-164992462 ACACCCTACCCAGATAATTTTGG - Intergenic
1018794217 6:167173360-167173382 CCACCACACTTGGCTAATTTTGG - Intronic
1018822102 6:167381669-167381691 CCACCACACTTGGCTAATTTTGG + Intronic
1018967940 6:168503228-168503250 CCACCATGCCCAGCTAATTTTGG + Intronic
1019753678 7:2751231-2751253 CCAACATACTCGGCTAACTTTGG - Intronic
1019793358 7:3031894-3031916 CCACCATGCCCAGCTAATTTTGG - Intronic
1020047494 7:5052910-5052932 CCACCACACCCGGCTAATTTTGG + Intronic
1020062928 7:5166157-5166179 CCACCATGCCTGGCTAATTTTGG + Intergenic
1020065519 7:5185463-5185485 CCACCACGCCCGGCTAATTTTGG - Intergenic
1020076260 7:5260973-5260995 CCACCATGCCCAGCTAATTTTGG + Intergenic
1020169205 7:5832006-5832028 CCACCACACCCAGCTAATTTTGG + Intergenic
1020283116 7:6661040-6661062 CCACCATGCCTGGCTAATTTTGG - Intergenic
1021289351 7:18823824-18823846 CCACCACACCTGGCTAATTTTGG - Intronic
1021860018 7:24896917-24896939 CCACCATGCTCGGCTAATTTTGG - Intronic
1022165989 7:27762797-27762819 CCACCATGCCTGGCTAATTTTGG - Intronic
1022457037 7:30566536-30566558 CCACCATGCTTGGCTCATTTTGG + Intergenic
1023052996 7:36269156-36269178 CCAAACTACTCAGCTTATTTAGG + Intronic
1023358336 7:39390241-39390263 CCACCATGCCCAGCTAATTTTGG - Intronic
1023500339 7:40843355-40843377 CCACCATGCCCAGCTAATTTTGG - Intronic
1023927450 7:44680057-44680079 CCACCATGCCTGGCTAATTTTGG - Intronic
1024083387 7:45874070-45874092 CCACCATGCCTGGCTAATTTTGG + Intergenic
1024193368 7:47034913-47034935 CCACCACACCCAGCTAATTTCGG + Intergenic
1024258242 7:47555246-47555268 CCACCACACCCGGCTAGTTTTGG - Intronic
1024640951 7:51328031-51328053 CCACCACACTCAGCTAATTTTGG + Intergenic
1025066340 7:55858996-55859018 CCACCATGCCCAGCTAATTTTGG - Intronic
1025100071 7:56127081-56127103 CCACCATGCCTGGCTAATTTTGG - Intergenic
1025104528 7:56160299-56160321 CCACCACACCTGGCTAATTTTGG - Intergenic
1025171642 7:56763616-56763638 CCACCACACCCAGCTAATTTTGG + Intergenic
1025845163 7:65189670-65189692 CCACCACACCCGGCTAATTTTGG + Intergenic
1025895438 7:65695697-65695719 CCACCACACCCGGCTAATTTTGG + Intergenic
1026083277 7:67241162-67241184 CCACCACATCCGGCTAATTTTGG - Intergenic
1026215880 7:68348425-68348447 CCACCCCACTCCCCTAAATTTGG + Intergenic
1026313270 7:69206764-69206786 CCACCATGCTTGGCTAATTTTGG - Intergenic
1026354586 7:69546386-69546408 CCACCACACCCGTCTAATTTTGG - Intergenic
1026768161 7:73173450-73173472 CCACCACACTCAGCTAATTTTGG + Intergenic
1026927044 7:74201672-74201694 CCACCATGCCCGGCTAATTTTGG + Intronic
1026987034 7:74561194-74561216 CCACCACACCTGGCTAATTTTGG - Intronic
1027044626 7:74983162-74983184 CCACCACACTCAGCTAATTTTGG + Intronic
1027079012 7:75219201-75219223 CCACCACACTCAGCTAATTTTGG - Intergenic
1027109928 7:75429476-75429498 CCACCACACCTGGCTAATTTTGG - Intronic
1027174293 7:75893493-75893515 CCACCATGCCTGGCTAATTTAGG + Intergenic
1027332799 7:77116949-77116971 CCATCATGCTCGGCTAATTTTGG - Intergenic
1027367992 7:77478498-77478520 CCACCATGCCCAGCTAATTTGGG + Intergenic
1027849380 7:83430175-83430197 CCACCGTACCCGGCCCATTTTGG - Intronic
1028568428 7:92259104-92259126 CCACCACACCTGGCTAATTTTGG + Intronic
1029069605 7:97884394-97884416 CCACCACACCTGGCTAATTTTGG - Intergenic
1029142617 7:98422232-98422254 CCACCACACCTGGCTAATTTTGG - Intergenic
1029206793 7:98874171-98874193 CCACCATGCCCAGCTAATTTTGG + Intergenic
1029292833 7:99515680-99515702 CCACCATGCCCAGCTAATTTTGG - Intronic
1029388245 7:100257771-100257793 CCACCACACTCAGCTAATTTTGG - Intronic
1029472664 7:100764340-100764362 CCACCATGCCTGGCTAATTTTGG - Intronic
1029502170 7:100938521-100938543 CCACCACACCCAGCTAATTTTGG - Intergenic
1029577055 7:101410665-101410687 CCACCACGCCCGGCTAATTTTGG + Intronic
1029591797 7:101511838-101511860 CCACCATGCCCAGCTAATTTTGG - Intronic
1029727538 7:102417140-102417162 CCACCACACCTGGCTAATTTTGG + Intronic
1029782984 7:102754351-102754373 CTATCATGCTCGGCTAATTTTGG + Intronic
1029865035 7:103618963-103618985 CCACCATGCCTGGCTAATTTTGG - Intronic
1030129545 7:106186589-106186611 CCACCAGACCTGGCTAATTTTGG + Intergenic
1030308502 7:108044798-108044820 CCACCATGCCTGGCTAATTTTGG - Intronic
1030652818 7:112133566-112133588 CCACCATGCCCGGCTATTTTAGG - Intronic
1030924750 7:115437923-115437945 CCACCACGCCCGGCTAATTTTGG + Intergenic
1031461102 7:122050288-122050310 CCACCACACCTGGCTAATTTTGG - Intronic
1031586412 7:123535739-123535761 CCACCACCCCCGGCTAATTTTGG + Intergenic
1031827496 7:126584375-126584397 CCACCATGCCCGACTAATTTTGG + Intronic
1031944766 7:127828147-127828169 CCACCATGCCCGGCTAATTTTGG + Intronic
1032040793 7:128558902-128558924 CCACCATGCCTGGCTAATTTTGG + Intergenic
1032337698 7:131041738-131041760 CCACCACACTCGGCTAATTTTGG - Intergenic
1032465991 7:132145393-132145415 CCACCCTACTTGGGTAAAATTGG + Intronic
1032601922 7:133306545-133306567 CCACTATACCCAGCTAATTTTGG - Intronic
1032783796 7:135185020-135185042 CCACCATGCCTGGCTAATTTTGG + Exonic
1032863476 7:135903562-135903584 CCACCACACCCGGCTAAATTTGG - Intergenic
1032952657 7:136932875-136932897 CCACCATGCCCAGCTAATTTTGG - Intronic
1033040392 7:137912222-137912244 CCACCACACCCAGCTAATTTTGG - Intronic
1033101382 7:138475661-138475683 GCACCATACCCAGCTAATTTTGG + Intronic
1033195480 7:139323740-139323762 CCACCAAGCCCGGCTAATTTTGG + Intergenic
1033235220 7:139632941-139632963 CCACCGCACCCTGCTAATTTGGG - Intronic
1033266182 7:139889177-139889199 CCACCACACCCAGCTAATTTTGG - Intronic
1033281982 7:140012609-140012631 ACACCATGCTTGGCTAATTTGGG + Intronic
1033358788 7:140623160-140623182 CCACCACACCTGGCTAATTTTGG - Intronic
1033434360 7:141319688-141319710 CCACCATGCCTGGCTAATTTTGG + Intronic
1033546626 7:142406936-142406958 CCACCATACCCGGCCGATTTTGG + Intergenic
1033883643 7:145917558-145917580 CCACCACACCTGGCTAATTTTGG - Intergenic
1033920551 7:146386539-146386561 CCACCATGCCTGGCTAATTTTGG + Intronic
1034121247 7:148629850-148629872 CCACCACGCCCGGCTAATTTTGG - Intergenic
1034340120 7:150347409-150347431 CCACCACACCCAGCTAATTTTGG + Intergenic
1034519686 7:151610214-151610236 CCACCATGCCCGGATAATTTTGG - Intronic
1034912187 7:155005886-155005908 CCACCACACCTGGCTAATTTTGG + Intergenic
1035678869 8:1473081-1473103 CCACCACACCTGGCTAATTTTGG + Intergenic
1035845286 8:2857426-2857448 CCACCACACCCAGCTAATTTTGG - Intergenic
1036248938 8:7145271-7145293 CCACCACACGTGGCTAATTTTGG + Intergenic
1036953571 8:13163852-13163874 TCACAATACTTGGCTAATTTTGG - Intronic
1037673389 8:21034588-21034610 CCATCATGCTCGGCTAATTTGGG + Intergenic
1037728714 8:21505771-21505793 CCACCATGCCTGGCTAATTTTGG - Intergenic
1037914362 8:22763658-22763680 CCAGCCTACTAGGCTAATTAAGG + Intronic
1038016732 8:23521985-23522007 CCACCACTCCCGGCTAATTTTGG - Intergenic
1038041173 8:23725593-23725615 CCACCATATCTGGCTAATTTGGG - Intergenic
1038224365 8:25642139-25642161 CCACCACACTCAGCCAATTTTGG + Intergenic
1038261674 8:26001699-26001721 CCACCATGCCCAGCTAATTTTGG + Intronic
1038336004 8:26646016-26646038 CCACCATGCCCGGCTAATTTTGG + Intronic
1038714249 8:29977603-29977625 CCACCATGCCTGGCTAATTTTGG - Intergenic
1038795084 8:30702782-30702804 CCACCACACTTGGCTAGTTTTGG - Intronic
1038826158 8:31004521-31004543 CCACCATGCCCAGCTAATTTGGG - Intronic
1038827634 8:31022121-31022143 CCACCATGCCTGGCTAATTTTGG + Intronic
1039252496 8:35682115-35682137 CCACCACACCCGGCTAATTTTGG + Intronic
1039460370 8:37738490-37738512 GTAGCCTACTCTGCTAATTTGGG + Intronic
1039527644 8:38231241-38231263 CCGCCCTACTCCGCTAATCCCGG + Intronic
1039634258 8:39145881-39145903 CCACCACACCTGGCTAATTTTGG + Intronic
1040025772 8:42780751-42780773 CCACCATGCCTGGCTAATTTTGG + Intronic
1040693595 8:49969547-49969569 CCACCATGCCCAGCTAATTTTGG + Intronic
1040876859 8:52162056-52162078 CCACCACACCTGGCTAATTTTGG - Intronic
1041061140 8:54035771-54035793 CCACCACACCTGGCTAATTTTGG + Intergenic
1041087128 8:54267244-54267266 CCACCACACTCAGCTAATTTGGG - Intergenic
1042308112 8:67352341-67352363 CCACCATGCCCAGCTAATTTTGG - Intergenic
1042891044 8:73610383-73610405 CCACCATACCTAGCTAATTTTGG - Intronic
1043063218 8:75530943-75530965 CCACCACACCCAGCTAATTTTGG + Intronic
1043469823 8:80551141-80551163 CCACCATGCCCGGCTAATTTTGG + Intergenic
1043596855 8:81897554-81897576 CCACCATGCCTGGCTAATTTTGG - Intergenic
1044078909 8:87859798-87859820 CCACCACACCTGGCTAATTTTGG - Intergenic
1044573415 8:93743992-93744014 CCACCCTTCTCGGACAACTTTGG + Intergenic
1044670200 8:94672683-94672705 CCACCATTCCCGGCTAATTTTGG + Intronic
1044975551 8:97661788-97661810 CCACCACACCTGGCTAATTTTGG - Intronic
1044978766 8:97693866-97693888 CCACCACACCTGGCTAATTTTGG + Intronic
1045031989 8:98145751-98145773 CCACCATGCCTGGCTAATTTTGG - Intronic
1045271882 8:100669133-100669155 CCACCATACTCAGGTAATTAAGG + Intergenic
1045638195 8:104217419-104217441 CCACCACACCTGGCTAATTTTGG + Intronic
1045810181 8:106212191-106212213 CCACCATGCCCGGCTAGTTTTGG + Intergenic
1045964553 8:108009894-108009916 CCACCACACTTGACTAATTTTGG - Intronic
1046537909 8:115539703-115539725 CCACCATGCCTGGCTAATTTTGG - Intronic
1046560203 8:115827000-115827022 CCACCATGCCTGGCTAATTTGGG + Intergenic
1046621554 8:116533909-116533931 CCACCATGCCCGGCTAATGTAGG + Intergenic
1046715750 8:117564709-117564731 CCATCACACCCGGCTAATTTTGG - Intergenic
1046757582 8:117987933-117987955 CCACCATGCTCAGCTAATTTTGG - Intronic
1047324344 8:123821815-123821837 CCACCACACCCAGCTAATTTTGG - Intergenic
1047632894 8:126727542-126727564 CCACCACACTAGGCTAATTTTGG + Intergenic
1047728247 8:127703462-127703484 CTACCATGCCCGGCTAATTTTGG + Intergenic
1047964776 8:130038532-130038554 CCACCACACCCAGCTAATTTTGG - Intergenic
1048140386 8:131788625-131788647 CCACCATGCCCAGCTAATTTTGG + Intergenic
1048706915 8:137163994-137164016 CCACCATGCCCAGCTAATTTTGG + Intergenic
1048883021 8:138885714-138885736 CCACCACACCCGGCTAGTTTTGG + Intronic
1049083515 8:140460059-140460081 CCATCCTGCCCAGCTAATTTTGG - Intergenic
1049559971 8:143305190-143305212 CCACCATGCCCAGCTAATTTTGG + Intronic
1050717690 9:8548518-8548540 CCACCAAACCTGGCTAATTTTGG + Intronic
1050729172 9:8688410-8688432 CCACCACGCCCGGCTAATTTTGG - Intronic
1050958357 9:11693872-11693894 CCACCATGCCTGGCTAATTTTGG + Intergenic
1051123099 9:13773607-13773629 CCACCACACCCAGCTAATTTTGG + Intergenic
1051302087 9:15662826-15662848 CCACCACACCCAGCTAATTTTGG - Intronic
1051437796 9:17051719-17051741 CCACCACACCCGGCTAATTTTGG + Intergenic
1051640447 9:19220039-19220061 CCACCATGCCTGGCTAATTTTGG - Intergenic
1051837186 9:21353538-21353560 CCACCACACCTGGCTAATTTTGG + Intergenic
1052421293 9:28246269-28246291 CCACCATGCCCGGCTAATTTTGG - Intronic
1052660333 9:31420590-31420612 CCACCATGCCTGGCTAATTTTGG - Intergenic
1052909480 9:33867764-33867786 CCACCATGCCCAGCTAATTTTGG - Intronic
1053140460 9:35679567-35679589 CCACCATGCCCGGCTATTTTTGG - Intronic
1053326125 9:37153321-37153343 CCACCATGCCTGGCTAATTTTGG + Intronic
1053613932 9:39744488-39744510 CCACCACACCCAGCTAATTTTGG + Intergenic
1053637175 9:40021612-40021634 CCACCAAACTCAGATAATTTTGG + Intergenic
1053708418 9:40779718-40779740 CCACCACGCCCGGCTAATTTTGG + Intergenic
1053768854 9:41443309-41443331 CCACCAAACTCAGATAATTTTGG - Intergenic
1053871963 9:42502441-42502463 CCACCACACCCAGCTAATTTTGG + Intergenic
1054239584 9:62597905-62597927 CCACCACACCCAGCTAATTTTGG - Intergenic
1054318008 9:63618459-63618481 CCACCAAACTCAGATAATTTTGG + Intergenic
1054418327 9:64900513-64900535 CCACCACGCCCGGCTAATTTTGG + Intergenic
1054547522 9:66354786-66354808 CCACCAAACTCAGATAATTTTGG - Intergenic
1054553716 9:66632432-66632454 CCACCACACCCAGCTAATTTTGG - Intergenic
1055359673 9:75476269-75476291 CCACCACACCCGGCTAATTTTGG - Intergenic
1055564253 9:77551985-77552007 CCACCACACCTGGCTAATTTTGG - Intronic
1055710064 9:79050951-79050973 CCACCATGCCTGGCTAATTTTGG + Intergenic
1056032185 9:82564581-82564603 CCACCCTCCTCATCAAATTTAGG + Intergenic
1056157487 9:83852779-83852801 CTACCATACCCGGCTAATTTTGG + Intronic
1056429600 9:86514152-86514174 CTACCACACTTGGCTAATTTTGG + Intergenic
1056664412 9:88570269-88570291 CCACCATGTCCGGCTAATTTTGG + Intronic
1056733082 9:89182357-89182379 CCACCATGCCCGGCTAGTTTTGG - Intergenic
1056987150 9:91373867-91373889 CCACCATGCCCAGCTAATTTTGG + Intergenic
1056990580 9:91406530-91406552 CCACCATACCCAGCTAATTTTGG + Intergenic
1057089131 9:92240414-92240436 CCACCATGCCTGGCTAATTTTGG + Intronic
1057114417 9:92507058-92507080 CCACCACACTCAGCTAATTCTGG + Intronic
1058453883 9:105121298-105121320 CCACCATGCCCGGCTAATTTTGG - Intergenic
1058658636 9:107248503-107248525 CCACCACACCCAGCTAATTTTGG + Intergenic
1058933039 9:109740804-109740826 CCACCACACCCAGCTAATTTTGG + Intronic
1058992201 9:110265290-110265312 CCACCATACCCAGCTAATTTTGG - Intergenic
1059067916 9:111104512-111104534 CCGCCACACTTGGCTAATTTTGG + Intergenic
1059475455 9:114543188-114543210 CCACCATGCCCGGCTAATTTTGG - Intergenic
1059544629 9:115164007-115164029 CCACCACGCCCGGCTAATTTTGG - Intronic
1059831008 9:118095893-118095915 CCACCACACCCAGCTAATTTTGG + Intergenic
1060085077 9:120691339-120691361 TAACCCTACTCTGTTAATTTTGG + Intronic
1060190029 9:121586665-121586687 CCACCTTGCCTGGCTAATTTTGG - Intronic
1060344074 9:122801439-122801461 CCGCCATGCTTGGCTAATTTTGG - Intronic
1060491705 9:124089947-124089969 CCACCACACCCAGCTAATTTTGG + Intergenic
1060592223 9:124824713-124824735 CCACCATGCCCGGCTAATTTTGG - Intergenic
1060648821 9:125306643-125306665 CCACCACACCTGGCTAATTTTGG + Intronic
1060944945 9:127564718-127564740 CCACCATGCCCGGCTAATTTTGG - Intronic
1060945066 9:127565639-127565661 CCACCATGCTTGGCTGATTTTGG - Intronic
1061109766 9:128560531-128560553 CCACCACACCCAGCTAATTTTGG + Intronic
1061317370 9:129804707-129804729 CCACCGTGCTCAGGTAATTTTGG - Intronic
1061346078 9:130026339-130026361 CCACCCTGCCTGGCTAATTTTGG - Intronic
1061516645 9:131093964-131093986 CCACCATGCCCAGCTAATTTTGG + Intronic
1061748908 9:132761413-132761435 CCACCATGCTCGGCTAATTTTGG + Intronic
1061966351 9:134015927-134015949 CCACCATGCCCGGCTAATTTTGG - Intergenic
1062019474 9:134310011-134310033 CCACCACACCCAGCTAATTTCGG - Intergenic
1062223490 9:135434289-135434311 CCACCACACCCAGCTAATTTTGG + Intergenic
1062257423 9:135634279-135634301 CCACCATACCCTGCTAATTCTGG + Intronic
1062442487 9:136577061-136577083 CCGCCACACCCGGCTAATTTTGG + Intergenic
1062492275 9:136811643-136811665 CCACCACACCCAGCTAATTTTGG + Intronic
1062738014 9:138149230-138149252 CCACCATGCATGGCTAATTTTGG - Intergenic
1202785047 9_KI270719v1_random:5202-5224 CCACCAAACTCAGATAATTTTGG + Intergenic
1185633574 X:1535338-1535360 CCGCCACACTCGGCTAATTTTGG + Intronic
1185704239 X:2254797-2254819 CCACCACACTCAGCTAATTTTGG + Intronic
1185739807 X:2522615-2522637 CCACCATGCCCGGCTAATTTTGG - Intergenic
1185772727 X:2777438-2777460 CCACAACACTTGGCTAATTTTGG - Intronic
1185844417 X:3424204-3424226 CCACCACACCTGGCTAATTTTGG - Intergenic
1186323720 X:8456522-8456544 CCACCATGCCCGGCTAATTTTGG + Intergenic
1186503822 X:10074157-10074179 CCACCATACCTAGCTAATTTTGG + Intronic
1186746052 X:12570456-12570478 CCACCACACATGGCTAATTTTGG + Intronic
1187349285 X:18497143-18497165 CCACCACCCCCGGCTAATTTAGG + Intronic
1187463392 X:19507421-19507443 CCACAGTGCCCGGCTAATTTTGG - Intronic
1187539316 X:20176021-20176043 CCACCAAACCTGGCTAATTTTGG + Intronic
1187898985 X:24009835-24009857 CCACCACACCCAGCTAATTTTGG - Intronic
1187987855 X:24833930-24833952 CCACCATACCCAGCTAATTTTGG - Intronic
1188487516 X:30699515-30699537 CCATCATGCCCGGCTAATTTTGG + Intronic
1188501995 X:30837199-30837221 CCACCATGCCCAGCTAATTTTGG + Intronic
1189123671 X:38423222-38423244 CCACCACACCCAGCTAATTTTGG - Intronic
1189254362 X:39626260-39626282 CCACCACACCTGGCTAATTTTGG + Intergenic
1189465037 X:41272029-41272051 CCACCATGCCCGGCTAGTTTTGG - Intergenic
1189541564 X:41996668-41996690 CCACCATGCCTGGCTAATTTTGG + Intergenic
1189786374 X:44562227-44562249 CCATCATGCCCGGCTAATTTTGG - Intergenic
1189812250 X:44791387-44791409 CCACCACACCCAGCTAATTTTGG - Intergenic
1189861725 X:45279236-45279258 CCACCATGCCCAGCTAATTTTGG + Intergenic
1190052194 X:47158552-47158574 CCACCATGCCCAGCTAATTTTGG + Intronic
1190153264 X:47966373-47966395 CCACCACACCCGGCTAATTTTGG - Intronic
1190858537 X:54321047-54321069 CCACCATGCGCCGCTAATTTTGG + Intronic
1192317044 X:70061299-70061321 CCACCATACTTGGCTAATTTTGG - Intergenic
1192439724 X:71165676-71165698 CTACCATGCCCGGCTAATTTTGG + Intronic
1193109775 X:77716588-77716610 CCACCATGTTTGGCTAATTTTGG - Intronic
1193152977 X:78143677-78143699 CCACCATGCCCAGCTAATTTTGG + Intergenic
1194453121 X:94069404-94069426 CCACCACACCCGGCTAATTTTGG + Intergenic
1194671991 X:96745157-96745179 CCACCATGCCTGGCTAATTTTGG + Intronic
1195652530 X:107300211-107300233 CCACCATGCCCAGCTAATTTTGG - Intergenic
1195690363 X:107619284-107619306 CCACCACACCCGGCTAATTCTGG + Intergenic
1196049824 X:111293036-111293058 CCACCACACCCAGCTAATTTTGG + Intergenic
1196088745 X:111715563-111715585 CCACCACACCCAGCTAATTTGGG - Intronic
1196668941 X:118345927-118345949 CCTCCCTTCTCGGCTACTTCCGG + Intergenic
1196742287 X:119035833-119035855 CCACCATGCCTGGCTAATTTTGG - Intergenic
1197787045 X:130208846-130208868 CCACCATGCCCGGCTAATTTTGG + Intronic
1198098410 X:133402748-133402770 CCACCATGCTCGGCTAATTTTGG - Intronic
1198257589 X:134938017-134938039 CCACCATGCCCGGCTAATTCGGG + Intergenic
1198318950 X:135499275-135499297 CCACCACACCCAGCTAATTTTGG + Intergenic
1198450405 X:136762065-136762087 CCATCATGCTCAGCTAATTTTGG + Intronic
1198465430 X:136900710-136900732 CCACCACACTTGGCTAATTGTGG + Intergenic
1198617926 X:138479103-138479125 CCACCATGCCTGGCTAATTTTGG + Intergenic
1198894013 X:141430652-141430674 CCACTGTGCTCGGCTAATTTTGG + Intergenic
1199254106 X:145699138-145699160 CCACCACGCCCGGCTAATTTTGG + Intergenic
1200118448 X:153779479-153779501 CCACCACACCCGACTAATTTTGG + Intronic
1200180844 X:154149893-154149915 CCACCATTCCCAGCTAATTTGGG + Intronic
1200186487 X:154187007-154187029 CCACCATTCCCAGCTAATTTGGG + Intergenic
1200192139 X:154224145-154224167 CCACCATTCCCAGCTAATTTGGG + Intronic
1200197894 X:154261949-154261971 CCACCATTCCCAGCTAATTTGGG + Intronic
1200214360 X:154360892-154360914 CCACCATGCCCAGCTAATTTTGG - Intronic
1201317190 Y:12659343-12659365 CCACCACACCCGGCTAATTTTGG + Intergenic
1201379881 Y:13363336-13363358 CCACCACACCCAGCTAATTTTGG + Intronic