ID: 976768154

View in Genome Browser
Species Human (GRCh38)
Location 4:88620365-88620387
Sequence CAGGGTAAGAAACAGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768154_976768158 -1 Left 976768154 4:88620365-88620387 CCTTAAACCTGTTTCTTACCCTG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 976768158 4:88620387-88620409 GTTTTCTTCATCTCTGTAAATGG 0: 1
1: 0
2: 20
3: 97
4: 764
976768154_976768162 29 Left 976768154 4:88620365-88620387 CCTTAAACCTGTTTCTTACCCTG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 976768162 4:88620417-88620439 ATTCTTCAGGCCAAAAACCTTGG 0: 1
1: 1
2: 18
3: 100
4: 484
976768154_976768159 16 Left 976768154 4:88620365-88620387 CCTTAAACCTGTTTCTTACCCTG 0: 1
1: 0
2: 1
3: 33
4: 267
Right 976768159 4:88620404-88620426 AAATGGCCTTTCCATTCTTCAGG 0: 1
1: 0
2: 1
3: 29
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768154 Original CRISPR CAGGGTAAGAAACAGGTTTA AGG (reversed) Intronic
902293593 1:15451071-15451093 CAGGGTCAGAGAGAGATTTAAGG + Intergenic
903490281 1:23723120-23723142 TAGGGGCAGAAACAGGTTTAGGG + Intergenic
903754318 1:25650232-25650254 CTGGGTAAGAAACAATGTTAAGG - Intronic
904318248 1:29679995-29680017 CAGGGTCTGAAACAGGGTGAAGG - Intergenic
904613938 1:31739696-31739718 CAGGGGAAGAGACAGATGTAGGG + Intronic
905389750 1:37628808-37628830 AAGGGGAAGAAACAGGTCTAAGG - Intronic
906440816 1:45842216-45842238 CAGGAAAAGGAACAGGTTTGGGG + Intronic
906737085 1:48140747-48140769 CAGAGTAGGAAAAAGGTTGATGG + Intergenic
907265388 1:53256739-53256761 CAGGGTTGGAAAGAGGTATAAGG + Intronic
907440807 1:54476873-54476895 CAGAGGAGGAAGCAGGTTTAGGG + Intergenic
909455191 1:75842218-75842240 CAGGTTAAGATAAAGGATTATGG + Intronic
909530985 1:76681541-76681563 AAGGCTAACAAACAGGTTTTTGG - Intergenic
910375824 1:86568938-86568960 GAGGATAAGAATCATGTTTAGGG - Intronic
911137781 1:94459794-94459816 CAGGGACAGAAACAGATTTGTGG - Intronic
911489134 1:98540701-98540723 CAGGCTAAGAAACAGGTGGATGG - Intergenic
913269356 1:117077812-117077834 GAGGGTAAGAAACAGATACAGGG + Intronic
913419508 1:118649496-118649518 AAGGGTTAGAAACAGCTTTTGGG + Intergenic
916813834 1:168331224-168331246 GAGGTTAAGAAACTTGTTTAAGG + Intergenic
917213741 1:172657075-172657097 GAGGGTAAGGAACAGGTCTCAGG + Intergenic
917701114 1:177582211-177582233 CAGGGGCAGAAAGAGGCTTAAGG + Intergenic
918552790 1:185762994-185763016 AAGGTTAAGGAACAGGGTTAGGG + Intronic
919074324 1:192795509-192795531 AAGGCAAAGAAACAGATTTAGGG + Intergenic
919186815 1:194161645-194161667 CAGGAAAAGAAACAGGTTGGAGG + Intergenic
919885430 1:201930531-201930553 CAGGAGGAAAAACAGGTTTAGGG + Intronic
920161316 1:204000138-204000160 CAGGGCAAGAAAGAGGTATTAGG - Intergenic
920180273 1:204128126-204128148 AATGGTAAGAACCAGGTATAAGG - Intergenic
922107410 1:222524562-222524584 CAGGCTAAGAAACAGGCCCAAGG + Intronic
924439742 1:244076400-244076422 CAAGTTAAGAAACAGATTAAAGG + Intergenic
1063738531 10:8790830-8790852 CAGGGTAAGAAAATGATTCAGGG + Intergenic
1063862584 10:10327745-10327767 CTGGGTAATAAACAGGTTTCTGG - Intergenic
1064191888 10:13213668-13213690 CAGGGAAAGAAACAGGCTTTCGG - Intergenic
1064720543 10:18224820-18224842 CAGGAGCAGAAACAGGTTAAAGG + Intronic
1065742027 10:28805672-28805694 CAGGGCAAGAAAAAGGAGTAGGG - Intergenic
1066290184 10:34007167-34007189 CACAGTCAGAAACAGGCTTAGGG + Intergenic
1067564106 10:47324534-47324556 CAGGGTAAGTGAGAGGATTAAGG + Intronic
1068107397 10:52635871-52635893 CAGGGTATGAAATATTTTTATGG - Intergenic
1068142290 10:53023969-53023991 AAGGGGCAGAAATAGGTTTAAGG - Intergenic
1068257025 10:54524945-54524967 CAGGATGAGAAAGAAGTTTATGG + Intronic
1070483022 10:76903642-76903664 GAGTGTAAGAAATAGGGTTATGG + Intronic
1072159167 10:92750287-92750309 CAGGAGAAGAAACATCTTTAAGG - Intergenic
1075836682 10:125459698-125459720 CAGAGAAAGAAACATGTTCAAGG + Intergenic
1078508323 11:11967984-11968006 CAGGGGAAGCAACAGGTGTAGGG + Intronic
1079361069 11:19770717-19770739 CAGGGTAAAAAATAAGTTTCAGG - Intronic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080241198 11:30129027-30129049 AAGGCTAAGAAACAGCTATATGG + Intergenic
1080532302 11:33188872-33188894 GATGGTTAGAAACAGGTTAAAGG - Intergenic
1083169635 11:60915319-60915341 CAGGTTAAGTAACAGGCGTAAGG + Intronic
1083259031 11:61513287-61513309 CAGGGCAAGAAACAGGGTTGGGG + Intergenic
1087390255 11:97521968-97521990 CAGGTTAAGATAAAGGATTATGG + Intergenic
1087593457 11:100222435-100222457 CATGGAAACAAACAGGTTTGAGG + Intronic
1087600659 11:100310926-100310948 CAGGACAAGGAACAGGTTTCTGG + Intronic
1088941120 11:114457333-114457355 CAGGATAAGAAACATGATTTTGG + Intergenic
1089172600 11:116525783-116525805 CAGGGTAAGAAACTTGTCCAGGG - Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1089758303 11:120703488-120703510 CAGTGGAAGAAACAGGCTTCAGG - Intronic
1097008548 12:55936275-55936297 CAGGGAAAGGAAGATGTTTAGGG + Intronic
1097561391 12:61210391-61210413 AAGGGGAAGAAACAGGACTACGG - Intergenic
1098256459 12:68621098-68621120 CAGAGGAAGAAAAAGGTTTAGGG + Intronic
1098781785 12:74696333-74696355 CAGATTAAGAAACAACTTTAAGG - Intergenic
1098905992 12:76163000-76163022 CAGGGAAGGAAACAGATTTAGGG - Intergenic
1100464784 12:94835230-94835252 CAGGGGAAGAACCAGGGGTAAGG - Intergenic
1101264909 12:103074098-103074120 AAAGGTAAGAAACATGTTTACGG + Intergenic
1102004338 12:109579564-109579586 CAAGGTGGGAAACAGGTTCAGGG + Intronic
1102868380 12:116392649-116392671 GAGGGTAAGAAACAAATTCAGGG + Intergenic
1104803766 12:131572098-131572120 CAGGGTAAGATACACGTGTGGGG + Intergenic
1104987513 12:132605140-132605162 CAGGAGAAGAAACAGGCTCAGGG + Intronic
1106084926 13:26533148-26533170 AAGGGAAAGAACCAGGTTTGAGG - Intergenic
1106212319 13:27661343-27661365 CATGGTAAGAGCCAGATTTAAGG - Intronic
1106895025 13:34290720-34290742 CATGGGAAGAAACAGGCTTGTGG - Intergenic
1107202766 13:37741404-37741426 CAGGGCAAGAATCAGTTTTAAGG + Intronic
1107272648 13:38638430-38638452 TGGGGTAAGAAACAGGATTTGGG - Intergenic
1109069464 13:57746354-57746376 CTAGTTAAGAAACTGGTTTAAGG + Intergenic
1109375146 13:61483015-61483037 CTGGGTAAGAAACTGGATTCTGG + Intergenic
1110042897 13:70787867-70787889 CAGGCTATGAAGCAGGTGTAAGG + Intergenic
1110161441 13:72383006-72383028 CAGGGGTAGAAAAAGGTTTAAGG + Intergenic
1111461436 13:88547557-88547579 AACGGTAAGGAACAGGTGTAGGG - Intergenic
1112209852 13:97365077-97365099 AAGGGAAAGAAACAGGTTAGCGG - Intronic
1112357858 13:98689744-98689766 CAGGCTGAGAGACAGCTTTAAGG + Intronic
1112413694 13:99186956-99186978 CTAGGTAAGAAACTGGTTTGAGG - Intergenic
1113848303 13:113404477-113404499 CAGGCCCAGAAACAGGTTCAAGG - Intergenic
1114257435 14:21015453-21015475 TTGGGTAACAAACAGGGTTATGG - Intergenic
1114429019 14:22644674-22644696 CAGAGGAAGAAGCAGGTTGATGG - Intergenic
1114564027 14:23614827-23614849 CAGGTTAGGAAACAGATTAAAGG + Intergenic
1115993303 14:39171347-39171369 CAGGCTAAGCAACATGCTTACGG - Intergenic
1116199824 14:41777902-41777924 CAGAGTCAGAAACAGGATTAAGG - Intronic
1117954659 14:61113112-61113134 GAGGTTAAGAAACATTTTTAAGG - Intergenic
1120632887 14:86912474-86912496 CAGTGTAGGAAAAATGTTTAGGG - Intronic
1120984799 14:90325169-90325191 CACGGGAAGAAAAAGGTTTGGGG + Intronic
1121167789 14:91823838-91823860 AAGGTTAAGTAACAGATTTAAGG - Intronic
1121386988 14:93536939-93536961 CAAGGTAAGAAAAAGTTTCAAGG - Intronic
1121394183 14:93604245-93604267 CAGGATAAGAAATAGGTTTTGGG - Intronic
1123056955 14:105575266-105575288 GAGGGCAAGAAACATGTTTTCGG - Intergenic
1123081255 14:105696519-105696541 GAGGGCAAGAAACATGTTTTCGG + Intergenic
1123981852 15:25612093-25612115 CAGGGCTAGAAACAGGATGAGGG + Intergenic
1124785456 15:32674890-32674912 CAGGCCAAGAAAGAGATTTAAGG + Intronic
1126124700 15:45284813-45284835 CAGGTTAAGAAAGAGGATTATGG - Intergenic
1126317683 15:47387823-47387845 CAGATGAAGAAACAGGTTTCAGG - Intronic
1126437916 15:48654727-48654749 TAGGGGAAGAAACAAGTTTAGGG - Intergenic
1126646515 15:50880264-50880286 CAGGCTAAGAAAGAGGCTTTGGG - Intergenic
1127159038 15:56161183-56161205 CATTGTGAGAAACAGGTTTTGGG - Intronic
1127879717 15:63146033-63146055 TAAGGGAAGAAACAGATTTAGGG - Intronic
1128510340 15:68310447-68310469 CAGGGTGAGAAACTGGTATCTGG + Intronic
1129151679 15:73692808-73692830 CAGGGAAATAACCAGTTTTATGG + Intronic
1129829245 15:78657313-78657335 TTGGGTAAGAAACAGGTTTGAGG - Intronic
1130913066 15:88284233-88284255 TAGGGTCAGAAACAGGCTTGTGG - Intergenic
1131690982 15:94827191-94827213 TAGGAGAAGAAGCAGGTTTAAGG - Intergenic
1133814431 16:9185635-9185657 CAGGTTCAGAAACATGTTTCAGG - Intergenic
1134794170 16:17019343-17019365 CAAGTTAAGATACTGGTTTAGGG - Intergenic
1135046095 16:19157046-19157068 CAGTGGAAGAAGCAGGTTTAGGG + Intronic
1135073344 16:19371505-19371527 CAGGGTAAAAATCAGGATTCAGG + Intergenic
1135225163 16:20649609-20649631 CAGGTTAAGATAAAGGTTTGTGG - Intronic
1136637085 16:31531246-31531268 CAGGGTAGGATTCAGGTTGAGGG - Intergenic
1137243502 16:46681284-46681306 CAGCTTAAGAAAAAGTTTTAAGG - Intronic
1138877887 16:60975087-60975109 GAGGGTCAGAAGCAGGTTTAAGG - Intergenic
1140158724 16:72461905-72461927 CAGAAAAAGATACAGGTTTAAGG + Intergenic
1140443332 16:75003507-75003529 CAGGTAAGGAAACAGGTTTGGGG + Intronic
1140816915 16:78629618-78629640 CAGGGTAGGTAGCAGGTTTCTGG - Intronic
1140822847 16:78679210-78679232 CATGGTAAGAAACGGGTTCTAGG - Intronic
1142467014 17:141869-141891 CAGGGTCAGAGTCAGGGTTAGGG - Intergenic
1144460834 17:15457548-15457570 ACGGGACAGAAACAGGTTTACGG - Intronic
1145841791 17:28001207-28001229 CAGGATAACAGACAGGTTAAGGG + Intergenic
1146266914 17:31458791-31458813 CAGGGTGTGAAACACGTTTGGGG + Intronic
1146530636 17:33604836-33604858 CAGGGAAAGAACGAGTTTTAGGG - Intronic
1146603255 17:34236348-34236370 CAGAGTAAGACCCAGGGTTAGGG - Intergenic
1147897090 17:43758003-43758025 AAGGGGAAGAAACAGGTTCCAGG - Intronic
1147936668 17:44015272-44015294 CAGGGTTGGAATCAGGATTAGGG - Intronic
1148405098 17:47405926-47405948 CTGGGTAATAAACATGTTTAAGG + Intronic
1149161347 17:53697005-53697027 GAGGGTAATGAAGAGGTTTATGG + Intergenic
1149303538 17:55327412-55327434 CAGATAAAGAAACAGGCTTATGG + Intergenic
1150202555 17:63372374-63372396 AAGGGTAAGGATCAGGGTTAAGG + Intronic
1151379995 17:73719327-73719349 CTGGGAGAGAAACAGGTTTGGGG + Intergenic
1152041587 17:77907074-77907096 CAAGGGAAGAAACAGGTTTCTGG - Intergenic
1154285723 18:13054608-13054630 CAGATGAAGAAACAGGTTGAGGG - Intronic
1155146211 18:23085834-23085856 CAGGTTAAGATACAGGATTGTGG + Intergenic
1155404999 18:25478119-25478141 CAGGGGAAGGAGGAGGTTTACGG - Intergenic
1156648565 18:39197358-39197380 CAGGATAACAAACAGGATTGAGG - Intergenic
1158803904 18:60946706-60946728 TAGGGTAAGATAAAGGTTGAGGG - Intergenic
1159973629 18:74683100-74683122 CAGGGTAGAAAGCAGTTTTATGG + Intronic
1160118994 18:76110187-76110209 CAGGGTAAAATTCAGGTTAATGG - Intergenic
1160152555 18:76406168-76406190 CAGGGTAAAAGAGAGGTTTGGGG - Intronic
1160262417 18:77307074-77307096 AATGGTAAGGAACAGATTTAAGG + Intergenic
1160613655 18:80108395-80108417 CAGGGTCAGAATTAGGGTTAAGG + Intergenic
1162519347 19:11170254-11170276 GAGGGCAAGGAACAGGATTATGG + Intronic
1163708168 19:18829100-18829122 CAAGGTAAGCTACTGGTTTATGG - Intergenic
1164490707 19:28711459-28711481 CTGGGAGAGAAACAGGTTTGGGG + Intergenic
1166301357 19:41913595-41913617 CAGGGTGAGCAGCAGGTCTAGGG - Intronic
925876130 2:8312574-8312596 CAGGGAAAGAAAGAGGCTTAGGG - Intergenic
926206372 2:10836845-10836867 CAGGGTAGCAGACAGGGTTATGG + Intronic
926789618 2:16556939-16556961 CAGGAGAAGGAACAGGTTTGTGG + Intronic
926855686 2:17253441-17253463 CAGGACTAGAAACAGGCTTAGGG - Intergenic
928358410 2:30642286-30642308 CAGGATCAGAAACAGCTTTGGGG - Exonic
929304154 2:40340816-40340838 GAGGGTAAGAAAAAGTTTGAAGG + Intronic
929384408 2:41387166-41387188 TAGGGGAAGAAATAGGTTTTTGG - Intergenic
929579321 2:43071616-43071638 CAGGGTGGGGGACAGGTTTAGGG + Intergenic
929862749 2:45693462-45693484 CAGGGCAAGGCCCAGGTTTAGGG + Intronic
936406840 2:112212359-112212381 CACATTAAGAAACAGGTTTAAGG - Exonic
936615881 2:114047257-114047279 CAGGGTAAAAAACTGGCTAAAGG - Intergenic
936653277 2:114454808-114454830 CAGGGTAGGAAAGAGGGTGAAGG - Intronic
937469007 2:122159285-122159307 TAGGGTTAGAATCAGGGTTAGGG - Intergenic
937615541 2:123917747-123917769 CAGGAAAAGAACCAGGTTTAGGG - Intergenic
937971020 2:127549608-127549630 CAGGGGCAGAAGCAGGTTTGGGG + Intronic
938570795 2:132560319-132560341 GAGGGTGCCAAACAGGTTTATGG - Intronic
938599327 2:132821304-132821326 CTAGGGATGAAACAGGTTTAGGG + Intronic
938990816 2:136627735-136627757 CAGGGTAAGGAAGATGTTAAAGG - Intergenic
939916649 2:148052812-148052834 CAGGATAAGTCACATGTTTATGG - Intronic
941421435 2:165287032-165287054 GAGGGGAAGAAGTAGGTTTAAGG + Intronic
942421146 2:175809277-175809299 CAGGGTAGAAAAGAGATTTAGGG + Intergenic
943085518 2:183306463-183306485 CTGGGTAAGAAACTTGTTGAAGG - Intergenic
944285769 2:197948267-197948289 CTGGAGTAGAAACAGGTTTATGG + Intronic
944940711 2:204622693-204622715 GAGGGTAAGTAACATGTCTAAGG + Intronic
945405399 2:209441629-209441651 CAGAGTAAGAAAAGGATTTAGGG + Intronic
945424641 2:209685174-209685196 CTTGATAAGAAACAGCTTTAGGG - Intronic
945503030 2:210601587-210601609 CAGGAAAAGAAACAGGCATATGG + Intronic
945654452 2:212606017-212606039 CAGGGAAAGAAACAGATCTATGG + Intergenic
948958254 2:241312043-241312065 CAGGGGAGGAAACATGATTAGGG + Intronic
1168876984 20:1178551-1178573 ATGGATCAGAAACAGGTTTAAGG - Intronic
1172845168 20:37925821-37925843 CAGGGAGAGAAGCAGGTTCAAGG - Intronic
1173339967 20:42144239-42144261 CTGGGTTAGAAACAGGATTGGGG + Intronic
1173626257 20:44475356-44475378 CAGAGCAAGAATCAGGTTTCAGG + Intergenic
1174613832 20:51820663-51820685 TCAGATAAGAAACAGGTTTATGG + Intergenic
1177047237 21:16185490-16185512 CAGGGTAAGAGTGATGTTTAGGG - Intergenic
1180184899 21:46134599-46134621 CAGGGTCAGGGTCAGGTTTAGGG + Intergenic
1180184923 21:46134677-46134699 CAGGGTGAGGGTCAGGTTTAGGG + Intergenic
1180749010 22:18111516-18111538 CAGGGTAGGAAACAGGTCGAAGG - Intronic
1181403390 22:22665424-22665446 CAGGGTCAGGAATAGGCTTAGGG - Intergenic
1182365003 22:29772692-29772714 CAGGGGAAGTAGCAGGTTTTAGG + Intergenic
1182482657 22:30619455-30619477 CAGGGTGAGAAGCAAGTGTAAGG - Intronic
1182956766 22:34434057-34434079 CAAGGTTAGAACCAGGTTTCAGG + Intergenic
1184423823 22:44397341-44397363 CAGTGAAAGAAACAGGTTCAGGG - Intergenic
1185083027 22:48720215-48720237 CAGGGTGAGGATCAGGCTTAGGG + Intronic
949823085 3:8136907-8136929 CAGGGGAAGAATCAGAGTTAGGG - Intergenic
949973501 3:9432689-9432711 AAGGATAAAAATCAGGTTTATGG - Intronic
950016494 3:9758333-9758355 CAGGGACAGAAACATGTTTTGGG - Intronic
950780342 3:15386351-15386373 AAGGGGCAGAAGCAGGTTTAAGG + Intronic
950875935 3:16273278-16273300 TAAGGTAAGAAACAAGTTTTTGG - Intronic
951953684 3:28230081-28230103 AAGGGAAAGAAACAGCATTAGGG - Intergenic
952808046 3:37375645-37375667 CAGAGAAAGAAAAAGGTTTCTGG - Intergenic
955660032 3:61288751-61288773 CAGAGAAAGAAAAATGTTTAGGG - Intergenic
956145054 3:66183795-66183817 CAGGGTAAGAGCCAAGTTCAGGG - Intronic
956145115 3:66184213-66184235 CAGTGTCAGAGACAGGTTTTGGG - Intronic
960702080 3:120449224-120449246 CAGAGGAAGAAACAGGTTTAAGG - Intronic
962042550 3:131722216-131722238 CAAGGTAAGGGTCAGGTTTAAGG - Intronic
962745462 3:138394681-138394703 CTGGGTGAGAAACAGGGTTTGGG - Intronic
962751609 3:138437876-138437898 CAGGATGAGAAACAGGTCTGGGG + Intronic
962933054 3:140055214-140055236 CAGAGTAAGAAAATGGTTTCTGG - Intronic
966261227 3:177981744-177981766 CTGGGTAGGAAACAGGCTCAGGG + Intergenic
973925135 4:55729384-55729406 AAGGATAAGAAACAAGTTGAGGG - Intergenic
974543430 4:63268916-63268938 CAGGGGAAGGAACATATTTATGG + Intergenic
974779635 4:66537111-66537133 CTGGGGAAGGAACAGGTTTGTGG + Intergenic
975824943 4:78309515-78309537 GAGGGTAAGAAACTTGCTTAAGG + Intronic
976768154 4:88620365-88620387 CAGGGTAAGAAACAGGTTTAAGG - Intronic
977525514 4:98141466-98141488 CAGGTTAAGATACAGGATTGTGG - Intronic
977804378 4:101279291-101279313 CAAGGTGAGAAACAAGTTTGGGG + Intronic
977898451 4:102391597-102391619 CTGGGTAAGAAACAGTTTGTAGG + Intronic
978195369 4:105965871-105965893 CAGGGTAACACAGAGGTTTGGGG + Intronic
979083085 4:116367705-116367727 CATTGTAAGAAACAGATTTTTGG + Intergenic
979985608 4:127310237-127310259 CTGGGGAAGAAACAAGTTTGAGG - Intergenic
981593991 4:146398574-146398596 CATAATAAGAAACAGATTTATGG + Intronic
982015475 4:151149172-151149194 CTGGTTAAGAAACTGGTTTTTGG - Intronic
982374711 4:154677189-154677211 CAGGAGAAGAAGCAGATTTAGGG + Intronic
983852058 4:172593244-172593266 CAAGGTAACAAACAAGATTATGG - Intronic
984151452 4:176137963-176137985 TAGGTGAAGAAACAGGTTTAGGG - Intronic
984436567 4:179717704-179717726 GAGGGGAAGAAGTAGGTTTAAGG - Intergenic
984821047 4:183882785-183882807 GAGGCTAAGAGACAGGCTTAAGG + Intronic
985039417 4:185874572-185874594 CAAGCTAAGAAGCAGCTTTAGGG + Intronic
985064334 4:186105567-186105589 CAGCGTAAGGAACAGGGTTCTGG - Intronic
985143286 4:186865170-186865192 AAGGCTAAAAAACAGATTTAAGG - Intergenic
987511851 5:18849560-18849582 CAGTGTCAGAAACAGAATTAAGG + Intergenic
990517072 5:56540234-56540256 CAGGGTAATAAACATTTTTCAGG + Intronic
991498243 5:67249302-67249324 CAGGGGAAGAAAAACATTTAGGG + Intergenic
991926287 5:71708268-71708290 TAAGGTAAGAAACAGAATTATGG - Intergenic
992282690 5:75198205-75198227 TAGGGTCTGGAACAGGTTTAAGG - Intronic
992677768 5:79122849-79122871 CAGGGTAAGAGAGAGGAATATGG + Intronic
996315719 5:122158547-122158569 GAGGGTAAGAAAGAGGGTCAAGG + Intronic
996391481 5:122967386-122967408 CAGGGTCTGAAAGAGGTTCAAGG - Intronic
997855912 5:137372505-137372527 CAGGGTAAGAAACAGCTAAGAGG + Intronic
998962779 5:147506613-147506635 AAGGGTAAGAAAGAAATTTAGGG + Intronic
1000141966 5:158413920-158413942 CAGGATAAGAAATATCTTTAAGG + Intergenic
1001841019 5:174876903-174876925 GAGGGCAAGAAACAGGTTGTGGG + Intergenic
1004144460 6:13051990-13052012 CAGGCGAGGACACAGGTTTAGGG - Intronic
1004398410 6:15266715-15266737 CAGGGTGAGAAACAGCTTTGTGG + Intronic
1005122454 6:22404637-22404659 CAGGATAAGACACAGTTTTCAGG - Intergenic
1006928034 6:37669599-37669621 CAGGGTCAGAAACATGGTTCTGG - Intronic
1007209595 6:40181700-40181722 CAGGGTAAGAAGTAGGATTAGGG + Intergenic
1009974861 6:70661756-70661778 AAAGATGAGAAACAGGTTTAGGG - Intergenic
1010438742 6:75867084-75867106 CAGCGTGGGAAACAAGTTTAAGG + Exonic
1011617703 6:89212192-89212214 CAGGGTGAGAGAGAAGTTTAGGG - Intronic
1011768611 6:90651624-90651646 CAGGTTAAGAAACATGGTTGTGG + Intergenic
1011872417 6:91912427-91912449 CCTTGTAAGAAACAGATTTAGGG - Intergenic
1014595079 6:123326076-123326098 CATGTTAAGAAGAAGGTTTAGGG + Intronic
1019846568 7:3508770-3508792 GAGGGAAATAAACAGGTTTGGGG - Intronic
1020610519 7:10390928-10390950 CAGGATAAGAAAAAGGATTGTGG - Intergenic
1020673402 7:11148546-11148568 CAGTGAAAGAAACAGGGTAAAGG - Intronic
1022192291 7:28027846-28027868 CAGGGAAAGAAACAGGCATCGGG - Intronic
1022738687 7:33100408-33100430 CAGGAAAAGAAACAGGCTTTTGG + Intronic
1024001648 7:45193921-45193943 CAGTGTAAGAAACATGTATGAGG + Intergenic
1024140321 7:46456390-46456412 CAGGGTCAGAAAAATGCTTAAGG + Intergenic
1030153529 7:106429050-106429072 CAGGGCAAGAAGCAGGAGTATGG - Intergenic
1031464387 7:122090806-122090828 AAGGGGAAAAATCAGGTTTAGGG - Intronic
1032357883 7:131227132-131227154 CAGGGAAAGAAACGGGTTACAGG - Intronic
1033015496 7:137666818-137666840 CAGGGTGGGAAACAGAATTATGG - Intronic
1033760659 7:144433252-144433274 CAGTGTAAGAACAAGGTTTGAGG - Intergenic
1034298753 7:149996738-149996760 CTGAGAAAGGAACAGGTTTAGGG - Intergenic
1034807264 7:154100043-154100065 CTGAGAAAGGAACAGGTTTAGGG + Intronic
1036774371 8:11599944-11599966 CAGGGAAAGAAGAATGTTTATGG + Intergenic
1037412148 8:18609292-18609314 CAGGCCAAGAAACAGGTATGTGG + Intronic
1037988410 8:23303858-23303880 AAGGGTAAGAAGCATGATTAAGG + Intronic
1040018598 8:42720412-42720434 CAGGGTAAGAAGCAGTCTGAGGG - Intronic
1041033303 8:53760598-53760620 GAGGGGCAGAAATAGGTTTAAGG - Intronic
1042454111 8:68979690-68979712 CAGAGAAAGAAAGAGGTTAAGGG + Intergenic
1042929138 8:73996301-73996323 AAGGAAAAGAAACAGGTTTTAGG - Intronic
1043768364 8:84165266-84165288 CAGGGTAAGAGTCAGGATCAAGG - Intergenic
1045556785 8:103222120-103222142 CAGGTTAAGAAAAAGGATTGTGG + Intronic
1045817729 8:106296268-106296290 CAGGGTAAGAAAGAGATCTTTGG - Intronic
1046531110 8:115446351-115446373 CAGGGGAAGAAACAGTTTTTGGG - Intronic
1049389988 8:142362840-142362862 CAGAGAAAGAAACAGATTCAAGG - Intronic
1049422055 8:142521376-142521398 CAGGGTAGGAACCAGGGATAGGG - Intronic
1051042979 9:12837029-12837051 CTGGGTAATGAATAGGTTTATGG + Intergenic
1051280031 9:15433549-15433571 CAGGGTTAGAAAAAGGTTCTTGG + Exonic
1051696391 9:19772295-19772317 CAAAGGAAGAAACAGCTTTAGGG + Intronic
1053073210 9:35113047-35113069 TAGTGTAAGGAACAGGGTTAAGG + Intronic
1056202577 9:84290787-84290809 GAGGTCAGGAAACAGGTTTAGGG - Intronic
1057405670 9:94768647-94768669 CAGGGTGAGACACAGGTCCACGG - Intronic
1060105869 9:120873141-120873163 CAGGGTAAGAAGCAGATTTTAGG - Intronic
1061732577 9:132627707-132627729 CAGGGCAAGAGACAGGTTCCTGG - Intronic
1061866190 9:133492894-133492916 CAGAAGAAGAAACAGGTTCAGGG + Intergenic
1186273150 X:7911681-7911703 CAGGGTGAGAAAAGGCTTTAGGG - Intronic
1186581279 X:10821769-10821791 AAGGGTGAGAAATATGTTTATGG - Intronic
1187056016 X:15742054-15742076 CAGTGGGAGAAACAGGTTTTGGG - Intronic
1187294306 X:17984280-17984302 CAGAGTCAGAGACAGGTTTGAGG - Intergenic
1187616207 X:20996015-20996037 CTAGGTAAGAAACTGGTTTGGGG + Intergenic
1188801232 X:34532653-34532675 CAGGCTAAGACACAGGTGTTGGG + Intergenic
1189755681 X:44269305-44269327 CAGAGCAAGAAACAGGATTGGGG - Intronic
1190493562 X:51006086-51006108 CAGGGTCAGAATCTGGTTTAGGG - Intergenic
1192134149 X:68581319-68581341 CTGGGGAAGAAACGGTTTTAAGG - Intergenic
1195664605 X:107417407-107417429 CAGATAGAGAAACAGGTTTAGGG + Intergenic
1196942614 X:120792045-120792067 CAAGGTAAGGAAGAGGTTGAAGG - Intergenic
1196970740 X:121105766-121105788 CAAGGTAAGGTACAGGTCTAAGG - Intergenic
1197786140 X:130199077-130199099 CAGAGTAAGAAACTCGTTAATGG + Intergenic
1198527285 X:137514265-137514287 CATGAGAAGAAACAGGTTGATGG + Intergenic
1199470384 X:148189030-148189052 CAGGGTAACAGAAAGGTTGAAGG - Intergenic
1201240079 Y:11950476-11950498 CAGTGAAAGACAGAGGTTTACGG - Intergenic