ID: 976768205

View in Genome Browser
Species Human (GRCh38)
Location 4:88620768-88620790
Sequence CAGGGTAAACACTCTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768205_976768208 -7 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data
976768205_976768212 5 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 113
976768205_976768213 21 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92
976768205_976768209 -6 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768205 Original CRISPR CAGGGTAAACACTCTGAGGA GGG (reversed) Intronic
900407250 1:2498171-2498193 CAGGCTGAGAACTCTGAGGAGGG - Intronic
901834343 1:11914169-11914191 AAGGGTAGCCAGTCTGAGGATGG + Intergenic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902391626 1:16110491-16110513 CAGGAAAACCGCTCTGAGGAGGG + Intergenic
902919120 1:19656178-19656200 CAGGGTAGGCGCTCTGTGGAAGG + Intronic
904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG + Intergenic
904703900 1:32376340-32376362 CAGAGTAGAGACTCTGAGGGAGG - Exonic
904842205 1:33379659-33379681 GAGGGTGAGCACACTGAGGATGG - Intronic
907888751 1:58618505-58618527 CAGGGGAAATACCCTAAGGAGGG - Intergenic
908504456 1:64782352-64782374 TAGGGTAAAAACTGTGAAGAAGG - Intronic
909949079 1:81697834-81697856 CAGGAAATGCACTCTGAGGAGGG - Intronic
913251289 1:116913615-116913637 CAGGGGAAACAATCAGAGTAGGG - Intronic
915602664 1:156932081-156932103 CGGGGTAAACACCCTCAGGCAGG - Intronic
918298464 1:183180490-183180512 CTGGGTAAATTCTCTGAGGCTGG - Intergenic
918517181 1:185375954-185375976 CAGGGAAAACAATCCGAGAAAGG - Intergenic
919005354 1:191891644-191891666 CATTGTAGACACACTGAGGATGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
923373111 1:233332348-233332370 CAGGGAAGGCACTCCGAGGAAGG + Intronic
923582941 1:235235873-235235895 CAGGGTAAATACTCAGTGCATGG + Intronic
924501234 1:244639772-244639794 AAAGGTAAACACTGTGAGGGTGG + Intronic
924706822 1:246509027-246509049 CAGGCTAATCACACTGTGGAGGG - Intergenic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1066367792 10:34793478-34793500 CAGAGTAAACTTTCTAAGGATGG - Intronic
1070467519 10:76738603-76738625 CAGGGAAAACACTCCAAGCATGG - Intergenic
1071191437 10:83106048-83106070 CAGTCTAAATACTCTAAGGAAGG + Intergenic
1071476710 10:86031865-86031887 CAGTGCAAAGACTCTGAGCAGGG - Intronic
1072278081 10:93842200-93842222 CAGGGTAAGCAGGCTTAGGATGG - Intergenic
1072884209 10:99259664-99259686 CTAGGTAAACACTCTAAGGCAGG + Intergenic
1073227597 10:101936538-101936560 CTTAGGAAACACTCTGAGGAAGG + Intronic
1075099554 10:119496488-119496510 CAGGGTAAACAGGCTTCGGACGG - Intergenic
1077413083 11:2412523-2412545 CAGGGTTCAGACTCTGACGAGGG + Intronic
1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG + Intronic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1078035156 11:7796205-7796227 CAGGGTAACCACAGTGAGGTGGG + Exonic
1079079601 11:17405109-17405131 CAAGGTAAACTCCCTGAGGTAGG + Intronic
1081198006 11:40185098-40185120 CAGTGTGAACACTTTTAGGAGGG + Intronic
1081718782 11:45271012-45271034 GATGGTAAACTCTCTGAGGGTGG - Intronic
1082294690 11:50425329-50425351 CAGGGTAAAAACTGGAAGGAAGG + Intergenic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1083859403 11:65411904-65411926 CTGGGCCACCACTCTGAGGAGGG + Exonic
1087289488 11:96304169-96304191 CAGTGTACAGATTCTGAGGAGGG + Intronic
1087671726 11:101114793-101114815 CAAGGAAAACAGTCTGGGGATGG - Intronic
1088878370 11:113954455-113954477 CAGGGTAAGCAGGCTTAGGACGG + Intergenic
1089914806 11:122143257-122143279 GAGGGTAAGAAATCTGAGGATGG - Intergenic
1090851056 11:130570916-130570938 CAGGGTCACCATTCTGAGGGCGG + Intergenic
1092950433 12:13498555-13498577 CAGGAAAGACACTCTGAGGGAGG - Intergenic
1095353606 12:41244601-41244623 CATGGGCAACACTCTGAGGCGGG - Intronic
1098240487 12:68462406-68462428 CATGGTAAATACTGTGAGTAAGG - Intergenic
1098308488 12:69124782-69124804 CAGGGTAAGCACTCAGATGTGGG - Intergenic
1099606283 12:84805764-84805786 AAGAGTAAGCACTCTGATGAGGG - Intergenic
1101531081 12:105574278-105574300 CAGGTTAAACATTCAGAGGTGGG + Intergenic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1109899876 13:68753570-68753592 CTGGGTATATACTCAGAGGATGG + Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112418162 13:99222154-99222176 CAGGGTTTACATTCTGATGAAGG + Intronic
1113033192 13:106017173-106017195 CAGAGTAAAAATTCTGAGCAAGG + Intergenic
1114617463 14:24075883-24075905 CACGGTAAAGACTCAGAGGGAGG + Exonic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117590761 14:57265804-57265826 CAGGATAGACATTCTGAGTAAGG - Intronic
1119693647 14:76695785-76695807 CAGGGAAGAAACCCTGAGGAGGG - Intergenic
1120310733 14:82824441-82824463 CAAGATAAACACTGTGAGGTAGG + Intergenic
1120356660 14:83442805-83442827 CAGGGTTAGGACTCTGAAGAAGG + Intergenic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1125361921 15:38873419-38873441 CAGCTAAAAGACTCTGAGGAAGG + Intergenic
1126020342 15:44394306-44394328 CAGGGGATACATTCTGAGAAAGG + Intronic
1126857023 15:52848469-52848491 CAGGAAAACCACTATGAGGAAGG - Intergenic
1126969249 15:54091103-54091125 CAGGGGAACCCCACTGAGGAAGG - Intronic
1128536437 15:68494182-68494204 CAGAGGAAGCATTCTGAGGAAGG - Intergenic
1129052391 15:72793310-72793332 CAGAGCAAAGACTCTTAGGAAGG - Intergenic
1129913963 15:79251621-79251643 GAGGCTAAACACGGTGAGGAGGG - Intergenic
1131305863 15:91242612-91242634 CAGTGTGAAGACTCTGAGGTGGG + Intronic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1136254402 16:29028738-29028760 CAGGGACCACCCTCTGAGGAAGG - Intergenic
1136267473 16:29130104-29130126 CCCGGTAGACACTCTGGGGAGGG - Intergenic
1138308658 16:56004085-56004107 CAGGTGAACCACCCTGAGGACGG - Intergenic
1139008754 16:62606709-62606731 CAGGTTAAATACGCTGAAGATGG - Intergenic
1140042739 16:71419773-71419795 CAGGGTAAACATACAGAGGAAGG + Intergenic
1140135877 16:72205078-72205100 CAGCCTAGACACACTGAGGATGG - Intergenic
1140981492 16:80113764-80113786 AAGTGTCAACACTCTGAGCAAGG + Intergenic
1141209758 16:81966588-81966610 TAGGGAAAACACTCTAAAGAGGG + Intergenic
1142006696 16:87692651-87692673 CAGGGTAAAGTCCCTTAGGATGG + Intronic
1145230720 17:21171534-21171556 CAGAGCAGACACTCAGAGGACGG - Intronic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148694763 17:49552191-49552213 CCGTGTAGACACTCTGCGGAGGG + Intergenic
1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG + Intergenic
1151984582 17:77534096-77534118 CAGGGTATACACACAGTGGATGG - Intergenic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1165116570 19:33532675-33532697 CACGGTAAACTGTCTGGGGAGGG + Intergenic
1165480336 19:36059818-36059840 CAGCGTAAACACCTGGAGGAGGG + Intronic
1165567924 19:36747859-36747881 CAGTGTGAACACTCTGATGTCGG + Exonic
1166364803 19:42272960-42272982 CTGGGTACTCACTGTGAGGAGGG + Intronic
1166511274 19:43410500-43410522 CATGGAAAAAATTCTGAGGATGG + Intronic
1168325378 19:55536269-55536291 CCCGGCAAACAGTCTGAGGAAGG - Exonic
925443269 2:3906553-3906575 CAGGGTCATCACTCAGAGAATGG - Intergenic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
931420044 2:62118678-62118700 CAGGATAAAACCTGTGAGGAAGG - Intronic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
936475837 2:112839047-112839069 CCGCATAAAGACTCTGAGGAAGG - Intergenic
939073783 2:137575818-137575840 AAGAGTAAACACTATTAGGAAGG - Intronic
939194898 2:138959598-138959620 CAGTGGTAACACTCTGGGGAGGG - Intergenic
939322188 2:140638489-140638511 AAGATTAAACTCTCTGAGGATGG + Intronic
941569974 2:167158542-167158564 CATGGTAAACTCTGTGAAGATGG - Intronic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
944897865 2:204183920-204183942 CAGGGTAAACGCAATGATGAGGG + Intergenic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946349324 2:219138807-219138829 CAGGGTAAACTCTATTGGGAAGG + Intronic
947678304 2:232005642-232005664 CAGGGTAAACAAAGGGAGGAAGG - Intronic
948744142 2:240073766-240073788 GAAAGTCAACACTCTGAGGAGGG - Intergenic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1170184385 20:13571870-13571892 CAGGGTGAAGACCCTGAGGCTGG - Intronic
1173261305 20:41438758-41438780 CAGGGAAAACACTCTCTGAATGG - Intronic
1175136650 20:56829277-56829299 AAGGGTAAACGCCCTGAGGTGGG - Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1178832169 21:36065076-36065098 CAGCTTAAACATTCTCAGGAAGG - Intronic
1185359962 22:50400200-50400222 CAAGGGAAACACTGGGAGGAAGG + Intronic
949789905 3:7781614-7781636 CAGGAAAAGCACTGTGAGGAGGG + Intergenic
950399702 3:12760457-12760479 CAGGGCAAAGGCCCTGAGGAGGG - Intronic
951328913 3:21341993-21342015 AAGGGCAATCTCTCTGAGGAAGG + Intergenic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
953170276 3:40500862-40500884 CAGGGTAAATTCTCTGATGTTGG - Intergenic
954064158 3:48092574-48092596 CAGAGGAAACAATATGAGGAGGG - Intergenic
956961597 3:74408735-74408757 TAGGGTAATTACTCTGAAGAAGG - Intronic
957957142 3:87202049-87202071 CAGGGAAAAGCCACTGAGGAGGG + Intergenic
958056179 3:88415385-88415407 CAGGGTTAAAACAATGAGGATGG + Intergenic
964011818 3:151900648-151900670 CAGGCTAAACATCCTGAGGTTGG - Intergenic
966892236 3:184415962-184415984 CATCGTAAAGGCTCTGAGGATGG - Intronic
967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG + Intergenic
969196178 4:5565761-5565783 AATGGTGAACACTCTGGGGATGG - Intronic
971452777 4:26815585-26815607 CATGTTACACACTCTGAGAATGG + Intergenic
975756771 4:77579059-77579081 CAAGGGCTACACTCTGAGGATGG + Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
977913773 4:102567071-102567093 GTGGGAAAACACTGTGAGGATGG + Exonic
978597318 4:110392313-110392335 CAGGGGAGACATTCTGAAGATGG + Intronic
978987241 4:115028288-115028310 CAGGATAAACACTCTTAACAAGG + Intronic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
984843551 4:184090887-184090909 CAGGATGAACTCTCTGAGCAGGG - Exonic
991189630 5:63854517-63854539 CAGGGTCAACACACTGATGGAGG - Intergenic
995743904 5:115383687-115383709 CAGAGTAAGCAGTCTGTGGATGG + Intergenic
997401487 5:133606642-133606664 CAGAGTAAACACACAGAGCAAGG + Intronic
999499609 5:152133518-152133540 CAGGTTCAAGAATCTGAGGAGGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1003397250 6:5763952-5763974 CAGAGTCCAAACTCTGAGGAGGG + Intronic
1004595629 6:17096778-17096800 CAGGGTAATAACTCAGAGAACGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1015785980 6:136922057-136922079 CAGGGAAGACGCTCTGCGGAGGG - Intergenic
1016307207 6:142696805-142696827 CAGGGTAAACAACCTGGGGCAGG - Intergenic
1016792212 6:148077882-148077904 CAGGGGAAACACCCTGAAGTAGG + Intergenic
1017358092 6:153534042-153534064 CAGATTAATCACCCTGAGGAGGG - Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1018202628 6:161409883-161409905 CAGGGTAAACTTTATGAGAATGG - Intronic
1019176781 6:170163466-170163488 CAGGGAAAGCACTGTGGGGACGG + Intergenic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1022687671 7:32611829-32611851 CAGAGAAAACACACTGAGGTTGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1025062370 7:55821399-55821421 CAAGGTAAAATCTCTGAGGCAGG - Intronic
1028482485 7:91322763-91322785 CTGGGTCATCACTCTCAGGAAGG + Intergenic
1028719222 7:94010632-94010654 CAGGGTAAATATTCTGTGGGTGG - Intergenic
1029170785 7:98627809-98627831 CAGGGTTAAGACCCTGAGCAGGG - Intronic
1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG + Intronic
1031979806 7:128117157-128117179 CAGATTACACACTCTGGGGATGG - Intergenic
1035417745 7:158704400-158704422 GAGGGGACACTCTCTGAGGACGG + Intronic
1037309167 8:17536639-17536661 CAGGCTAAACACTTTAAGTACGG + Intronic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1038334303 8:26634130-26634152 CAGGCTAGAAACTCTGAGGGCGG - Intronic
1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG + Intronic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1040816493 8:51513267-51513289 CGGCATAAACACTCTGAGGATGG + Intronic
1045485693 8:102629194-102629216 CAGGTTAATCACTCTGAAGGGGG - Intergenic
1046381995 8:113463530-113463552 CAGGGAAAACATTCTGGAGAAGG + Intergenic
1046697792 8:117361200-117361222 CAGGGTAAACACTTTGGAGCAGG - Intergenic
1047599855 8:126415042-126415064 AAGGGGAAACATTCTCAGGAAGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1049536901 8:143186609-143186631 CAGGGTAGAGACGCTGAGGTAGG - Intergenic
1050756802 9:9014665-9014687 CATGGGAGACAATCTGAGGAAGG + Intronic
1052514902 9:29467717-29467739 CTGGGTAAAATCTCTGAGGAAGG + Intergenic
1052615943 9:30842243-30842265 CAAGGAAGACACTCTGAGAAAGG - Intergenic
1053541014 9:38973813-38973835 CTGAGTAAACAATGTGAGGATGG - Intergenic
1053805435 9:41796861-41796883 CTGAGTAAACAATGTGAGGATGG - Intergenic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1054625126 9:67390094-67390116 CTGAGTAAACAATGTGAGGATGG + Intergenic
1056733191 9:89183231-89183253 CAGGGGATACTCTCTGTGGATGG - Intergenic
1057799037 9:98178596-98178618 AAGGGGAAACACTCTGAGAAAGG - Intronic
1058504593 9:105655350-105655372 CAGTGAAAAGGCTCTGAGGAAGG + Intergenic
1058725786 9:107802669-107802691 GAGGGCAAACAATCTGGGGAGGG + Intergenic
1058970125 9:110073722-110073744 CAGAGAAAAGACTCTGGGGAGGG - Intronic
1061820249 9:133223433-133223455 CAGGGTAAACAGGCTCAGGGCGG + Intergenic
1062240384 9:135534471-135534493 CAGGGTAAACAGGCTCAGGGCGG - Intergenic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188111162 X:26197497-26197519 CAAGGTAAAGATGCTGAGGAAGG + Intergenic
1191269150 X:58440185-58440207 CAGGGTAAAAACTAGAAGGAAGG - Intergenic
1191846288 X:65550324-65550346 CTGGGCCACCACTCTGAGGAGGG - Intergenic
1192038936 X:67596581-67596603 CAGACTGAACACACTGAGGAAGG - Intronic
1193078430 X:77380807-77380829 CAGGGTAAAGAGTCAGAGGTGGG + Intergenic
1194674563 X:96778819-96778841 CAGGGTAAACATTGTGGGCAAGG + Intronic
1196939193 X:120759246-120759268 CAGGGCAATCACTCTGTGAATGG - Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic
1197758467 X:130012326-130012348 CAGGGTAAACAGTCCAAAGAGGG + Intronic
1199271067 X:145883196-145883218 CAGTGTAAAGACTCTGAGGTGGG - Intergenic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic