ID: 976768208

View in Genome Browser
Species Human (GRCh38)
Location 4:88620784-88620806
Sequence TACCCTGCTATTCTGTAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768200_976768208 27 Left 976768200 4:88620734-88620756 CCCTGGCATACTCTGTTCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data
976768205_976768208 -7 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data
976768204_976768208 10 Left 976768204 4:88620751-88620773 CCTCTGGCTTCATTGGTCCCTCC 0: 1
1: 0
2: 2
3: 18
4: 240
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data
976768201_976768208 26 Left 976768201 4:88620735-88620757 CCTGGCATACTCTGTTCCTCTGG 0: 1
1: 0
2: 3
3: 11
4: 182
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data
976768206_976768208 -8 Left 976768206 4:88620769-88620791 CCTCCTCAGAGTGTTTACCCTGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 976768208 4:88620784-88620806 TACCCTGCTATTCTGTAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768208 Original CRISPR TACCCTGCTATTCTGTAACT TGG Intronic
No off target data available for this crispr