ID: 976768209

View in Genome Browser
Species Human (GRCh38)
Location 4:88620785-88620807
Sequence ACCCTGCTATTCTGTAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768207_976768209 -10 Left 976768207 4:88620772-88620794 CCTCAGAGTGTTTACCCTGCTAT 0: 1
1: 0
2: 1
3: 9
4: 98
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149
976768206_976768209 -7 Left 976768206 4:88620769-88620791 CCTCCTCAGAGTGTTTACCCTGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149
976768205_976768209 -6 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149
976768204_976768209 11 Left 976768204 4:88620751-88620773 CCTCTGGCTTCATTGGTCCCTCC 0: 1
1: 0
2: 2
3: 18
4: 240
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149
976768201_976768209 27 Left 976768201 4:88620735-88620757 CCTGGCATACTCTGTTCCTCTGG 0: 1
1: 0
2: 3
3: 11
4: 182
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149
976768200_976768209 28 Left 976768200 4:88620734-88620756 CCCTGGCATACTCTGTTCCTCTG 0: 1
1: 0
2: 1
3: 25
4: 287
Right 976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768209 Original CRISPR ACCCTGCTATTCTGTAACTT GGG Intronic
900927932 1:5717784-5717806 ACCCTGCTATTGAGGAAGTTTGG + Intergenic
901556056 1:10032591-10032613 CGCCTGCTTTTCTGTGACTTGGG - Intergenic
901790658 1:11652272-11652294 CCCCAGCTATTGTGTGACTTGGG + Intronic
902037283 1:13467051-13467073 ACTCTGCTATTCTAATACTTGGG + Intergenic
905443803 1:38011695-38011717 ACTATTCTTTTCTGTAACTTGGG - Intronic
907423905 1:54366451-54366473 AGCATACTAGTCTGTAACTTTGG - Intronic
907968325 1:59355719-59355741 AACCTACTATTGTGTAGCTTTGG - Intronic
911884597 1:103281481-103281503 ACCCTGCTATTCTGGGAATTTGG + Intergenic
912330390 1:108814986-108815008 ACCCTGCTGTGCTGTCACTAAGG + Intergenic
914421887 1:147536523-147536545 GCTCTGCTACTCTGTGACTTTGG - Intergenic
914428800 1:147601000-147601022 ACCCTGCTGTTGTTTTACTTAGG - Intronic
916175476 1:162034487-162034509 GCCTTGCTATTCTGGAAGTTGGG - Intergenic
916872443 1:168930943-168930965 CCCCAACTATTTTGTAACTTTGG - Intergenic
917785910 1:178457469-178457491 ACAGTGTTATTCTGTACCTTTGG + Intronic
918413405 1:184283912-184283934 ACCCTCCTCATCTGTAACTCAGG + Intergenic
919715352 1:200770142-200770164 TCCCTACAATTCTGTACCTTCGG - Intronic
920378157 1:205520321-205520343 ACCCTGAGATTCTGGAACTGAGG - Intronic
922305353 1:224339658-224339680 ACCCAGCAATTCTGTAACAGCGG - Intergenic
922320688 1:224483779-224483801 ACGCTTCTATTCTGCAACCTTGG + Intronic
924243161 1:242059084-242059106 AGGCTGCTGTCCTGTAACTTTGG + Intergenic
1064851189 10:19710215-19710237 ACACTGCTTTTCAGGAACTTAGG - Intronic
1066489163 10:35877486-35877508 GCCCTGCTGTTCGGTAGCTTAGG + Intergenic
1068228799 10:54142587-54142609 ACCCTGTTATTCTGACACATAGG - Intronic
1068376929 10:56192410-56192432 ATCCTGCTCTACTGTAACCTAGG + Intergenic
1070426806 10:76296712-76296734 TCCCTGCAATTCTGTTACTATGG - Intronic
1071412986 10:85414890-85414912 ACCCTGCTATACCCTGACTTGGG - Intergenic
1073170398 10:101502061-101502083 ACTCTACTACCCTGTAACTTTGG - Intronic
1073472171 10:103729653-103729675 ACCCTGCCATTCTGTAAACCAGG + Intronic
1076851342 10:133094928-133094950 AACATGCTTTTCTGTGACTTTGG + Intronic
1079059536 11:17236072-17236094 CGCCTGCTATCCTGGAACTTTGG + Intronic
1079481456 11:20884994-20885016 ACCCTGCTATTCTCCGACTTCGG - Intronic
1083423814 11:62572516-62572538 GCCCTGCGATTCTGTCACTCTGG - Intronic
1085515446 11:77109028-77109050 CCCCTGCGTTTCTGTAACCTGGG + Intronic
1087409754 11:97776564-97776586 ACCCTCCTAATGTGTAACTTGGG - Intergenic
1088429252 11:109740472-109740494 ATCCTGCTTTTTTGTAATTTTGG - Intergenic
1088815564 11:113418525-113418547 ATCCTGATATTCTGGCACTTGGG + Intronic
1089620532 11:119719777-119719799 ATCCTGCTATCCAGTCACTTGGG - Intronic
1090523046 11:127499293-127499315 ATCCTGCTATTCTGCACCTCTGG + Intergenic
1091530069 12:1346064-1346086 AGCCTGCTTTTCTATAACCTGGG + Intronic
1094098774 12:26738284-26738306 ACCCAGCTATTTTGTATGTTTGG + Intronic
1099476189 12:83110069-83110091 ACCTTGCTTTTCTGTCACTGAGG + Intronic
1102286895 12:111664918-111664940 ACACTGCTCTTCTGTAACACTGG + Intronic
1102425576 12:112841633-112841655 ACCCTGGCACTCTGTGACTTTGG - Intronic
1102813116 12:115841228-115841250 ACCCTGCTTTTCTGTAAATTGGG - Intergenic
1103259675 12:119575679-119575701 ACTCTGCTGTTCTCAAACTTGGG + Intergenic
1109054501 13:57530298-57530320 ACCCTGTTATTCTGAGACATGGG + Intergenic
1109487456 13:63045803-63045825 ACACAGCCATTCTGTTACTTAGG + Intergenic
1109954812 13:69551882-69551904 ACCCTGCCATACTTTAACCTAGG + Intergenic
1111836261 13:93392183-93392205 ACACTGCTATTCAATAACTGAGG + Intronic
1112627216 13:101118983-101119005 AGCCAGCTATTCAGCAACTTTGG - Intronic
1115095231 14:29627324-29627346 AGCCTCCTCTTCTGTCACTTTGG - Intronic
1115169409 14:30487087-30487109 ACTGTGCTATTCAGCAACTTTGG + Intergenic
1115382140 14:32752388-32752410 AGGTTGCTATTCTGTAACTTAGG + Intronic
1120259529 14:82164238-82164260 ACCCTGCTATTCTGACACATGGG - Intergenic
1120881686 14:89418754-89418776 ACCCTGCTTTCCTGTAGCTCCGG + Intronic
1121950112 14:98164166-98164188 ATCCTGTTGCTCTGTAACTTTGG - Intergenic
1124381107 15:29166931-29166953 ACCATGCTGTTTTGCAACTTTGG - Intronic
1128176751 15:65562857-65562879 ACTGTGCGATTCTGTATCTTGGG + Exonic
1128851356 15:70960253-70960275 ACCCTGCTAGTCTGATATTTTGG + Intronic
1129542225 15:76359763-76359785 TTCCTGCCCTTCTGTAACTTGGG - Intronic
1130891328 15:88136281-88136303 ACTCAACTTTTCTGTAACTTAGG - Intronic
1131493068 15:92879813-92879835 ACTCTACTTTTCTGTGACTTTGG - Intergenic
1139211943 16:65086683-65086705 ACCCTGGCCTTCTGTAACTGGGG - Intronic
1147727933 17:42578249-42578271 CCCCTGCAATTCTATCACTTTGG + Intergenic
1151014908 17:70543056-70543078 GCACTGCTACTCTTTAACTTTGG + Intergenic
1152017845 17:77763586-77763608 TCCCTGCAATTCTTCAACTTTGG + Intergenic
1155187330 18:23398658-23398680 TCACTGCTATTTTGCAACTTTGG + Intronic
1155799594 18:30083988-30084010 GCACTGATATTCAGTAACTTGGG + Intergenic
1158886251 18:61829824-61829846 CCCCTCCTATTCTGTAATCTGGG + Intronic
1159406435 18:68008593-68008615 AGCCTTCTCTTCTGTATCTTTGG - Intergenic
1159853641 18:73557790-73557812 GTTCTACTATTCTGTAACTTCGG + Intergenic
1162349918 19:10142490-10142512 ACCCTGCGATTCCCTAACTTGGG - Intronic
1165642163 19:37398805-37398827 ACCCTGCTATTCTGGGCCTTTGG + Intergenic
926717985 2:15940008-15940030 TCCCTGCTATTTTGCACCTTCGG + Intergenic
927004921 2:18838265-18838287 ACTTTGCTATTCTGTAAAGTGGG + Intergenic
927387356 2:22550342-22550364 ACCTTGCTCTTCTGTAATTCAGG - Intergenic
929989247 2:46771414-46771436 ACCATCCTATTTTGTAACCTTGG + Intergenic
933108801 2:78371039-78371061 ATCTTGCTACTCTGTCACTTGGG + Intergenic
938700546 2:133874982-133875004 ACCCTGTTATTCGGGCACTTGGG + Intergenic
939892786 2:147757476-147757498 ATCCTGCTTTTCTGTCTCTTAGG - Intergenic
940071697 2:149695843-149695865 AATGTTCTATTCTGTAACTTGGG + Intergenic
940704527 2:157087263-157087285 ACTCTGCTATTTTGTAGTTTGGG - Intergenic
941167063 2:162093875-162093897 CCCCTACTGTTCTGTAACCTAGG + Intergenic
941877619 2:170450824-170450846 ACCCTGCTATTCAGACACATGGG + Intronic
944930127 2:204508805-204508827 CCTCTGCCACTCTGTAACTTCGG + Intergenic
1168972785 20:1942231-1942253 ACCCTGATGTTCTGACACTTTGG - Intergenic
1170196938 20:13698898-13698920 ACACTACTATTTTATAACTTAGG - Intergenic
1173654185 20:44688349-44688371 ACCCTGCTTTTCAGTTATTTTGG - Intergenic
1175678854 20:60969640-60969662 ACTCTGTTTTTCTGTTACTTTGG - Intergenic
1178568775 21:33714461-33714483 ACCATGCTACTCTAGAACTTAGG - Intronic
1183696534 22:39426856-39426878 ACCCTGCTAGTGAGGAACTTTGG + Exonic
953035642 3:39208319-39208341 CCTCTGCTATTCAGCAACTTTGG - Intergenic
953066529 3:39477243-39477265 ACCCTGCAGTTGTGCAACTTTGG + Intronic
953176267 3:40555584-40555606 ACCCTGTTATTCTGACACATGGG + Intronic
953613231 3:44465477-44465499 ACCCTGTTATTCGGACACTTGGG - Intronic
956711086 3:72039475-72039497 ACCCAGGCATTCTGAAACTTGGG + Intergenic
959518801 3:107302347-107302369 AATCTTCTATTCTGTAGCTTAGG + Intergenic
962432259 3:135330309-135330331 ACCCTGATATTTTGTATCTTGGG + Intergenic
965409541 3:168313044-168313066 CTCTTGCTATTCTGTACCTTGGG + Intergenic
967249266 3:187520199-187520221 ACCCTGCTATTCTGAGACCCTGG + Intergenic
968537373 4:1142680-1142702 TCTCTGCTTTTATGTAACTTAGG + Intergenic
972190453 4:36585307-36585329 CTCCTGCAGTTCTGTAACTTTGG + Intergenic
972279177 4:37586190-37586212 ACCCTGCTACTGTGGGACTTTGG - Intronic
974546771 4:63321008-63321030 ACCCTGCTTTTCTGTTCATTAGG + Intergenic
975231082 4:71934188-71934210 ACCCTACTTCTCTGTCACTTAGG + Intergenic
976183381 4:82420613-82420635 ACCCTGCTTTTTTGTATTTTTGG + Intergenic
976768209 4:88620785-88620807 ACCCTGCTATTCTGTAACTTGGG + Intronic
977840453 4:101696735-101696757 ATTCTGTTATTCTGTAACTGAGG - Intronic
982522572 4:156437787-156437809 TCCCTACTATGCTGTAACCTTGG - Intergenic
983193585 4:164780967-164780989 ACCCGGCTATTTTTTAATTTTGG + Intergenic
984987105 4:185341971-185341993 ACCATTCTCTTCTGTAACCTTGG - Exonic
985192737 4:187394183-187394205 ACCCTGCTATAATCTAACTATGG + Intergenic
990714098 5:58617252-58617274 ACCCTGCTGTTCAGCCACTTTGG + Intronic
991956954 5:72004601-72004623 AAACTCCTATTCAGTAACTTGGG - Intergenic
992156049 5:73956278-73956300 AGCCTGCTTATCTGTAAATTTGG - Intergenic
996899703 5:128530429-128530451 ACTTTGCTATTCTGTAAAATGGG + Intronic
998952129 5:147402948-147402970 GCCCTGCACTTCTTTAACTTTGG + Intronic
1001804038 5:174568172-174568194 ACCATGCAATTCTTGAACTTTGG + Intergenic
1002331902 5:178448931-178448953 ACCATGCTTTTTTGTCACTTAGG + Intronic
1002932141 6:1642084-1642106 ACCCTGCTCTTCAGAAACTAAGG + Intronic
1006936383 6:37721538-37721560 TCCCTGGTAATCTGTTACTTTGG - Intergenic
1007152390 6:39706885-39706907 ATTCTTCTATTCTGTAAATTAGG - Intronic
1008656787 6:53623026-53623048 GCACTGCTATTCTGAAACTATGG + Intergenic
1009300711 6:62015446-62015468 ACCCTGCCACTCTTTACCTTAGG + Intronic
1010214616 6:73390373-73390395 ACCCTGGTATTAAGTATCTTTGG - Intronic
1012399650 6:98833416-98833438 ACCTTCCTAATCAGTAACTTCGG - Intergenic
1012873268 6:104696396-104696418 GCTCTGCTATTCTGTGACCTTGG - Intergenic
1013189955 6:107793783-107793805 ACCCAGCTATTTTGTATTTTTGG - Intronic
1013678032 6:112489003-112489025 ACCCTGCTATTATTTAAGGTAGG - Intergenic
1014652651 6:124059531-124059553 TCCCTGCTATTGTGGAGCTTAGG - Intronic
1015288708 6:131512816-131512838 AGCCTGCTATGATGAAACTTTGG + Intergenic
1017314236 6:153012104-153012126 CTCCTGCTATTCTGTGACTGGGG + Intronic
1017568301 6:155712557-155712579 ACCCTGTCATTCTGTCACATTGG - Intergenic
1022752341 7:33243023-33243045 ATCCAACTATTCTATAACTTGGG - Intronic
1023118638 7:36887069-36887091 TCCTTGCTCTTCTGTGACTTTGG + Intronic
1030453672 7:109745551-109745573 ACACTGCCATCCAGTAACTTTGG - Intergenic
1030733369 7:113016732-113016754 AACCTGCTTTTTTTTAACTTTGG + Intergenic
1031278768 7:119767828-119767850 ACCCTGCTATTTTCTAACATTGG - Intergenic
1031586785 7:123540076-123540098 CCCCTGCAATTATGCAACTTGGG - Exonic
1031839028 7:126714461-126714483 ATTCAGCTTTTCTGTAACTTAGG - Intronic
1045717818 8:105069115-105069137 ACCCTACCATTCTTTAAATTAGG - Intronic
1045833337 8:106490783-106490805 AGCCTTCTATTCTGTCACCTTGG + Intronic
1048495940 8:134936293-134936315 ACCCTGCCCTTGTGAAACTTAGG + Intergenic
1049301146 8:141871518-141871540 ACCCTGATATTGTGTGACCTTGG - Intergenic
1049301626 8:141873723-141873745 ACCCTGATATTGTGTGACCTTGG - Intergenic
1050994387 9:12195585-12195607 TATCTGCTGTTCTGTAACTTTGG - Intergenic
1053225727 9:36354810-36354832 ATGTTGCTATTCTGTAACTAAGG - Intronic
1056183287 9:84106519-84106541 AGCCTTCTCTTCTGTAAATTGGG - Intergenic
1058256484 9:102772117-102772139 ACCCTGCTGTTCTGTTCCATTGG + Intergenic
1058735970 9:107894483-107894505 GCCCTGGTTTTCTGTAACATGGG - Intergenic
1059952323 9:119478624-119478646 AACCTTGTATTCTGCAACTTTGG - Intergenic
1060529127 9:124337897-124337919 ACCTTGTTTTTCTTTAACTTTGG + Intronic
1186868674 X:13747685-13747707 ATCCTGCAATTCTGTAATCTTGG - Intronic
1190956957 X:55204984-55205006 ACCCTGTTATTCAGTCACATGGG + Intronic
1192539544 X:71956602-71956624 ACCCTGCCAGAATGTAACTTGGG - Intergenic
1193208737 X:78780234-78780256 GCACTGTGATTCTGTAACTTGGG + Intergenic
1195880625 X:109589482-109589504 TCCCAGCTTTTCTGTGACTTGGG + Intergenic
1196905299 X:120425582-120425604 ACCCTATTATTCTGGAACTATGG + Intergenic
1197171983 X:123444580-123444602 ACCCTGCCATTCAGTCACTTGGG - Intronic
1198061947 X:133054830-133054852 AACCAGTTATTCTGTAAGTTAGG - Intronic
1200417306 Y:2925897-2925919 GTCCTGCTATTATGTATCTTTGG + Intronic