ID: 976768212

View in Genome Browser
Species Human (GRCh38)
Location 4:88620796-88620818
Sequence CTGTAACTTGGGAACTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768205_976768212 5 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 113
976768206_976768212 4 Left 976768206 4:88620769-88620791 CCTCCTCAGAGTGTTTACCCTGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 113
976768204_976768212 22 Left 976768204 4:88620751-88620773 CCTCTGGCTTCATTGGTCCCTCC 0: 1
1: 0
2: 2
3: 18
4: 240
Right 976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 113
976768207_976768212 1 Left 976768207 4:88620772-88620794 CCTCAGAGTGTTTACCCTGCTAT 0: 1
1: 0
2: 1
3: 9
4: 98
Right 976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG 0: 1
1: 0
2: 1
3: 9
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768212 Original CRISPR CTGTAACTTGGGAACTATCT AGG Intronic
906309907 1:44746411-44746433 CCGTAACTGGGGAAGTTTCTGGG + Intronic
906768799 1:48463424-48463446 CTTTAGCTTATGAACTATCTAGG - Intronic
907654979 1:56333172-56333194 CTATAATTTGGGAATTATGTAGG - Intergenic
911734117 1:101318600-101318622 TTGTGGCTTGGGAACTTTCTTGG + Intergenic
912873758 1:113333840-113333862 CTTTTCCTTGTGAACTATCTAGG + Intergenic
917828759 1:178854282-178854304 CTGTAACTTGGGTATTATGTAGG - Intronic
918473851 1:184902895-184902917 CTGTATATTGAAAACTATCTAGG + Intronic
918640874 1:186839825-186839847 ATGAAACTTTGGAACTATGTTGG + Intronic
920655584 1:207872228-207872250 CTGTTCCTTGGCAACCATCTGGG - Intergenic
924572994 1:245255064-245255086 CATTATCTTGGGAATTATCTTGG + Intronic
1063188496 10:3671207-3671229 CTGTCTCTGGAGAACTATCTGGG + Intergenic
1065973202 10:30821510-30821532 CAGTGACTTGGGTACTTTCTGGG + Intronic
1068884617 10:62086042-62086064 CAGGAACTGGGGAACTATGTGGG - Intronic
1070402266 10:76063698-76063720 CTGAAAATTGGAAACTATTTGGG + Intronic
1071089134 10:81898368-81898390 CTGTCACTGAGGAGCTATCTGGG - Intronic
1071708502 10:88025666-88025688 TTGTTACTTGGGAGCTATCAAGG - Intergenic
1073596974 10:104810771-104810793 CTTTGCCTTGAGAACTATCTGGG + Intronic
1078159360 11:8827588-8827610 TGGTAACTTGGTAACTGTCTTGG - Intronic
1084280749 11:68090162-68090184 TAGTAATTTGGCAACTATCTTGG + Intronic
1092897082 12:13022372-13022394 CTCTAACTTGGGGACTATGCTGG + Intergenic
1093022571 12:14217360-14217382 CTGTACCCTAGGCACTATCTGGG + Intergenic
1096024441 12:48349424-48349446 CAGAAACTTGGTAACTATCCTGG + Intronic
1097683867 12:62674320-62674342 CTTTACCTTGGGAACCACCTTGG - Intronic
1097844827 12:64355664-64355686 CTCTTACTTAGGAATTATCTTGG - Intronic
1102501067 12:113352804-113352826 CAGTAACTTGAGACCAATCTGGG - Intronic
1104873858 12:132019402-132019424 CTTTAAGCTGGGAACTATATTGG - Intronic
1106778087 13:33027683-33027705 CAGTAACCTGGGAAATATCCTGG - Intronic
1107240127 13:38222961-38222983 CTATAAATTGGGAAAAATCTTGG - Intergenic
1110774288 13:79388880-79388902 CTGTAACTTGTGATCTTTTTTGG - Intronic
1113019809 13:105872349-105872371 GTGTTACATGGGAACTATCATGG - Intergenic
1114227932 14:20755714-20755736 CTCTCAGTTGGGATCTATCTGGG + Intergenic
1115005586 14:28479737-28479759 CTGTAAAGTGGGAACTATATTGG + Intergenic
1116711894 14:48378718-48378740 CTCTAACTTGCTTACTATCTTGG + Intergenic
1118075314 14:62291821-62291843 CTGTAAGCTGGGAACCATCTTGG + Intergenic
1122297018 14:100711488-100711510 CTGTAGCATGGGAATTATATAGG - Intergenic
1202892291 14_KI270722v1_random:169808-169830 CTGTAAGTTGGGAAAAATTTTGG - Intergenic
1124389777 15:29243877-29243899 ATATAACCTGGGAATTATCTAGG - Intronic
1124685625 15:31779435-31779457 CTGTTACATTAGAACTATCTTGG + Intronic
1129663335 15:77565472-77565494 CTGTGACTTGGGTAATAACTAGG - Intergenic
1130510755 15:84587418-84587440 ATGTAACCTGGGAACTCTCCAGG - Intergenic
1130961681 15:88663661-88663683 TTGCAACTTGGGTACTAGCTTGG + Intergenic
1133539520 16:6735745-6735767 ATGCCACTTGGGAACTATCATGG - Intronic
1134570630 16:15287863-15287885 ATGTAACTTGACAAATATCTGGG + Intergenic
1134731752 16:16468209-16468231 ATGTAACTTGACAAATATCTGGG - Intergenic
1134935697 16:18243792-18243814 ATGTAACTTGACAAATATCTGGG + Intergenic
1138699892 16:58851514-58851536 CTGTAAAGTGGGAACAATGTTGG - Intergenic
1138904267 16:61311290-61311312 GTCTAACTTTGGAGCTATCTGGG + Intergenic
1138959731 16:62014653-62014675 CTGTAACTTGGAAATCATTTGGG - Intronic
1140196666 16:72860958-72860980 CTGTAACTTGGGAAAACCCTGGG - Intronic
1142629389 17:1214843-1214865 CTGTAATGTGGCAGCTATCTCGG + Intronic
1142897973 17:2994513-2994535 CTGTATCTTAGGGACTAGCTAGG + Intronic
1143319248 17:6057290-6057312 CTGCAACTTCTGAACTTTCTTGG - Intronic
1145232810 17:21186941-21186963 CTGTCACTTGGTAACTCACTGGG + Intronic
1151036135 17:70802377-70802399 CTGTTTCTTGGGCACCATCTGGG - Intergenic
1151752912 17:76051718-76051740 CACTAACTTGGGAACGAACTGGG + Intronic
1152914859 17:83028767-83028789 ATGTACCTTGGGAAGTACCTAGG - Intronic
1156103780 18:33632124-33632146 CTGTAAGTAGGAAGCTATCTAGG - Intronic
1158612933 18:58959596-58959618 CTGTAACTTGGGAAGAGCCTGGG + Intronic
1166571637 19:43800563-43800585 CTGTGATTTGGGACCTCTCTGGG - Intronic
926342007 2:11911431-11911453 CTGAAACTAGGGAAATAACTAGG + Intergenic
927695681 2:25238197-25238219 ATGTATCTTGGGAACTCTCGGGG + Intronic
929982161 2:46691674-46691696 AGATAACTAGGGAACTATCTTGG - Intergenic
935390578 2:102548238-102548260 CTATACCTTGGGATCTAGCTTGG - Intergenic
936970325 2:118170614-118170636 TTGTAACTTGGAAAGTAGCTTGG - Intergenic
941825590 2:169892045-169892067 GTGTATCTTGTGAAATATCTAGG + Intronic
944610363 2:201398522-201398544 TTGTAACTTAGGAGGTATCTGGG - Intronic
948227807 2:236325564-236325586 CTGTAAGTGGGAAACTCTCTTGG + Intronic
1169644221 20:7791181-7791203 CTGTAACTTGGAGACTAAATTGG - Intergenic
1171454046 20:25256882-25256904 CTGCCACTTGGCAACTTTCTAGG + Intronic
1174317706 20:49715183-49715205 CTGAAACTAGGGTACTGTCTTGG + Intergenic
1176214994 20:63943815-63943837 CTGTAACCTGGGGACCACCTGGG + Intronic
1184375608 22:44110392-44110414 CTGTGACTTGAGACTTATCTTGG + Intronic
951624429 3:24644514-24644536 CTCATATTTGGGAACTATCTGGG - Intergenic
952176617 3:30870728-30870750 CTGCAACTTGGGAGATATTTAGG + Intronic
953702534 3:45207903-45207925 CTGTGACTTGGGCACCATGTTGG - Intergenic
957290285 3:78269889-78269911 CTGCTACTTGTTAACTATCTAGG - Intergenic
961870040 3:129980804-129980826 CTATAACCTGTTAACTATCTCGG - Intergenic
961980894 3:131077124-131077146 ATGTAACTTGGGAAGTCTCCGGG + Intronic
971073512 4:23122444-23122466 CTGTAAATTGTGAACCATTTAGG + Intergenic
972103672 4:35455086-35455108 CTGTAATTTGGAAGATATCTTGG + Intergenic
976768212 4:88620796-88620818 CTGTAACTTGGGAACTATCTAGG + Intronic
977214445 4:94262856-94262878 CTGTAACTGTTGAATTATCTGGG - Intronic
978430703 4:108630224-108630246 CTGTAACTTGAGTAGTATCTAGG - Exonic
978587679 4:110291666-110291688 CTGTAACTTCAGGTCTATCTGGG - Intergenic
982757853 4:159245477-159245499 CTGTCACTAAAGAACTATCTTGG + Intronic
984628515 4:182036056-182036078 CTGGAAGTTGGGATTTATCTAGG - Intergenic
987503824 5:18745413-18745435 CTGTATCCTGGGCACTATCTGGG - Intergenic
987856900 5:23431507-23431529 CTATGACTTTAGAACTATCTTGG + Intergenic
988140062 5:27225995-27226017 CTGTATCTTGGCAGGTATCTTGG - Intergenic
988148217 5:27338774-27338796 CTGTAACTTGGGAAGTTTGATGG + Intergenic
988974894 5:36505345-36505367 CTGGCACCTGGGAATTATCTTGG - Intergenic
990852776 5:60225658-60225680 TTCTAACATGGGAACTCTCTGGG + Intronic
993385824 5:87262028-87262050 TTGTAAGTTGGAAACTGTCTAGG - Intergenic
998452231 5:142243994-142244016 CTGTGACTTGGGAGAAATCTTGG - Intergenic
999871621 5:155757515-155757537 CTGTCACTTAGTAACTATTTAGG - Intergenic
1004601420 6:17154040-17154062 CTGTAACCTACGAATTATCTTGG + Intergenic
1004772984 6:18807330-18807352 CTGTCACTTAGTAGCTATCTAGG - Intergenic
1005967210 6:30735238-30735260 CTGTTACTGGTAAACTATCTAGG + Intronic
1007089081 6:39170740-39170762 CTGGAGCTTGGGAAATAGCTGGG - Intergenic
1010314795 6:74435588-74435610 CTGTAACTTGGAAATCAACTTGG - Intergenic
1010974069 6:82293302-82293324 CTTTAACTTAGAAACTCTCTTGG - Intergenic
1012499528 6:99873572-99873594 CTGTAACTTGGGAACTAAATTGG + Intergenic
1020770225 7:12381909-12381931 CTTTAAATTGAGAACTATCTGGG + Intronic
1022713580 7:32876248-32876270 CACTAACTTGGGCACTAACTTGG + Intronic
1029820829 7:103145026-103145048 CTGCATCTTGGGAACTCCCTTGG + Intronic
1031411985 7:121450205-121450227 CTGTAACCTCAGAACTACCTTGG - Intergenic
1033399689 7:141010290-141010312 CTGTACCTTTTGAACTACCTGGG + Intronic
1033635529 7:143208429-143208451 CTGTAACCAGGGAACTTTCCTGG - Intergenic
1037685979 8:21139790-21139812 TTGGAACTTGGAAACTATCTGGG - Intergenic
1038331249 8:26611222-26611244 CTGTCCCCTGGGAACTTTCTCGG - Intronic
1041619841 8:59954013-59954035 GTCAAACATGGGAACTATCTTGG + Intergenic
1043184911 8:77136047-77136069 CTAAAACTTGGGAAATATTTGGG - Intergenic
1044619809 8:94177680-94177702 CTGTGACTTTTGAACTAACTGGG - Exonic
1048053292 8:130839616-130839638 CTGTAACTTGGGAAGAAACTGGG + Intronic
1050183650 9:2947711-2947733 CTGTAATTGAGGAACTGTCTGGG - Intergenic
1051118040 9:13719883-13719905 CTGGAAATTGAGAACTTTCTTGG + Intergenic
1056244575 9:84681478-84681500 CTCTATGTTGGGAACTAGCTAGG + Intronic
1057417376 9:94876942-94876964 CTGTAAATTGGGAAAAATCTTGG - Intronic
1058352117 9:104038271-104038293 CTGTCATTTGGTAACTATATTGG - Intergenic
1061813145 9:133175227-133175249 TTGTAAATTGGGAAAAATCTTGG - Intergenic
1186014852 X:5179868-5179890 GTGTAACTTTGGAACCATTTAGG - Intergenic
1190076192 X:47318990-47319012 CTGTAAATTGGGAATCATCATGG + Intergenic
1193069663 X:77294799-77294821 CTGTAACTAGGAATCTATATAGG - Intergenic
1196427769 X:115589421-115589443 CTGTAATTTTGGGACTATATTGG - Intronic