ID: 976768213

View in Genome Browser
Species Human (GRCh38)
Location 4:88620812-88620834
Sequence ATCTAGGACCTATGTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976768210_976768213 3 Left 976768210 4:88620786-88620808 CCCTGCTATTCTGTAACTTGGGA 0: 1
1: 0
2: 1
3: 15
4: 151
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92
976768211_976768213 2 Left 976768211 4:88620787-88620809 CCTGCTATTCTGTAACTTGGGAA 0: 1
1: 0
2: 2
3: 16
4: 154
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92
976768207_976768213 17 Left 976768207 4:88620772-88620794 CCTCAGAGTGTTTACCCTGCTAT 0: 1
1: 0
2: 1
3: 9
4: 98
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92
976768205_976768213 21 Left 976768205 4:88620768-88620790 CCCTCCTCAGAGTGTTTACCCTG 0: 1
1: 0
2: 0
3: 7
4: 202
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92
976768206_976768213 20 Left 976768206 4:88620769-88620791 CCTCCTCAGAGTGTTTACCCTGC 0: 1
1: 0
2: 1
3: 10
4: 122
Right 976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG 0: 1
1: 0
2: 1
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976768213 Original CRISPR ATCTAGGACCTATGTTCCTC TGG Intronic
901585338 1:10285810-10285832 ATCTAGGAACTGGGTTCCTAAGG + Intronic
903046471 1:20567694-20567716 ATCTAGGACCTAACGTGCTCTGG + Intergenic
903536381 1:24069175-24069197 ATCTAGGTTCTTTCTTCCTCTGG + Intronic
904741477 1:32679685-32679707 ATCTAGGACCCTTGTCCTTCTGG - Exonic
906117544 1:43366540-43366562 ATCTAGGACCTTAGCTCATCAGG - Intronic
906266997 1:44439766-44439788 ATCTAGATCCTAAGTTCCTGTGG + Intronic
909822760 1:80086801-80086823 ATATATGACCTATGTTCATTTGG - Intergenic
913174275 1:116259851-116259873 ATCAAGGACCTAAGTTGGTCAGG + Intergenic
914455129 1:147829232-147829254 TTTTAGCATCTATGTTCCTCAGG + Intergenic
916899758 1:169208240-169208262 AACTAGGACATAAATTCCTCTGG + Intronic
917050123 1:170913494-170913516 CTCTAGGTCCTGTGTTCATCTGG - Intergenic
919105502 1:193145875-193145897 AGCTAGGACCAATGCACCTCTGG - Intronic
919668830 1:200320142-200320164 AGCCAGGAGCTATGTTCCTTGGG - Intergenic
922658236 1:227404790-227404812 TTCTAGCATCTATGTTCATCAGG - Intergenic
1069832623 10:71290519-71290541 AGCCAGGACCTTTGGTCCTCTGG + Intronic
1071294034 10:84206350-84206372 ATTCAGGACCTTTGCTCCTCTGG - Intronic
1076914910 10:133418571-133418593 ATTTAGAACCTGTGTTACTCAGG + Intronic
1078902755 11:15656604-15656626 ATTTAGGACCTCCATTCCTCAGG + Intergenic
1083779022 11:64908759-64908781 ATCGAGGACCCATGCTCCCCAGG + Intronic
1084856364 11:71990274-71990296 ACCCAGGACCTATGCTCATCGGG - Intronic
1086098477 11:83073151-83073173 ATCCATGACCGATGTTACTCTGG - Intergenic
1086230906 11:84568692-84568714 ATCTAGCACCTTTGCTTCTCTGG - Intronic
1088593458 11:111422650-111422672 ATATAGAACCTTTGTGCCTCAGG + Intronic
1096348192 12:50869721-50869743 TTTTAGCACCTATGTTCATCAGG - Intronic
1098324224 12:69284297-69284319 ATCGAGGACCTCTGGTTCTCTGG - Intergenic
1098612478 12:72477398-72477420 ATCTAAGGCTTATGTTCCTATGG - Intronic
1099476781 12:83117342-83117364 TTTTAGCATCTATGTTCCTCAGG - Intronic
1099687325 12:85907298-85907320 TTTTAGTACCTATGTTCATCAGG + Intergenic
1107372589 13:39768583-39768605 ATCTAGGCTCTAGGTTCCTGGGG + Intronic
1109973269 13:69798274-69798296 ATCTAGGGAATATATTCCTCTGG + Intronic
1119635171 14:76267703-76267725 CTCTAGGCCCTACGTTCCTCTGG + Intergenic
1121460173 14:94069583-94069605 TTTTAGGATCTATGTTCATCAGG - Intronic
1127536465 15:59894252-59894274 ATATAGGCCCTATGTTGCCCAGG - Intergenic
1129332334 15:74834090-74834112 ACATAGGACCTTTGTTCCTGCGG - Intergenic
1130641153 15:85676666-85676688 ATCTAGTAGTGATGTTCCTCAGG - Intronic
1133997450 16:10759215-10759237 GTCCAGCACCTGTGTTCCTCAGG - Intronic
1144642792 17:16947186-16947208 ATCTTGCATCTATGTTCCTCAGG - Intronic
1149093381 17:52812167-52812189 ATCTTTGAACCATGTTCCTCTGG + Intergenic
1149357906 17:55862629-55862651 ATTTAGGACCCCTGTTCATCAGG - Intergenic
1151533927 17:74726546-74726568 ATCTAGAATCTAACTTCCTCAGG - Intronic
1153205293 18:2692854-2692876 ATCTTGAACCTATCTTTCTCAGG + Intronic
1156198410 18:34802476-34802498 ATTTAGGAGCTATGCTCATCAGG - Intronic
1159428668 18:68322346-68322368 CTCTTGGACCTATGCACCTCTGG - Intergenic
1163330924 19:16637214-16637236 ATCAAGGACCTATGTTCCTAAGG - Intronic
926078977 2:9968200-9968222 AGCTAGGACCTATCTTACACTGG + Intronic
930751637 2:54940028-54940050 ATCTATGGCATATGTTCCTTAGG + Intronic
933181541 2:79232458-79232480 GTCGAGTACCTATGTTCATCAGG + Intronic
1172592350 20:36126802-36126824 ATCTAAGACCTAAGTTTCTCTGG - Intronic
1174021488 20:47533735-47533757 AGATAGGATCTATGTTGCTCAGG - Intronic
1176704873 21:10107639-10107661 ATGTAAAACATATGTTCCTCAGG + Intergenic
1177215242 21:18119590-18119612 AGCTTAGACATATGTTCCTCTGG - Intronic
1177301541 21:19251777-19251799 TTTTAGGATCTATGTTCATCAGG - Intergenic
1183106891 22:35621438-35621460 ATCTAGAACCCAAGTTTCTCCGG - Intronic
951230877 3:20178325-20178347 AACCAGGAAATATGTTCCTCTGG - Exonic
951846700 3:27092352-27092374 GTCTAAGCCCTAAGTTCCTCAGG - Intergenic
955139548 3:56255568-56255590 ATCTAGGCTGTATATTCCTCAGG - Intronic
958434023 3:94075906-94075928 ATCTAGGACCCTTGTCCTTCTGG + Intronic
963113193 3:141703071-141703093 TTTTAGCACCTATGTTCATCAGG - Intergenic
967743450 3:193028567-193028589 ATCTAGGAACTGTGTTCATTCGG - Intergenic
970454263 4:16206531-16206553 AGCTAAGACCTCTGTTCCTTAGG - Intronic
976768213 4:88620812-88620834 ATCTAGGACCTATGTTCCTCTGG + Intronic
978252227 4:106645773-106645795 ATTTTGCAACTATGTTCCTCAGG + Intergenic
981584613 4:146287339-146287361 CTTTGGGACCTATGTTCATCAGG - Intronic
982010608 4:151102506-151102528 CTCTCAGACCTATTTTCCTCTGG + Intronic
983825307 4:172250809-172250831 ATCAAGGTCCCATTTTCCTCTGG - Intronic
984742213 4:183176145-183176167 CTCTAGCCTCTATGTTCCTCTGG - Intronic
995625056 5:114067192-114067214 ATCTAGGAACAATATTGCTCTGG - Intergenic
996594848 5:125188637-125188659 AAATAGGACCTATATTTCTCTGG + Intergenic
998703089 5:144727716-144727738 ATTTTGCACCTATGTTCATCAGG + Intergenic
1000834705 5:166139744-166139766 ATTTTGCACCTATGTTCATCAGG - Intergenic
1002173880 5:177390714-177390736 CTCTAGGGCCTTTGTTCTTCTGG - Intronic
1013417994 6:109941386-109941408 AGGTAGGACCTCTTTTCCTCAGG - Intergenic
1016406797 6:143739738-143739760 ATCTTGGACCTTTATTCCTTCGG + Intronic
1020188003 7:5973680-5973702 ATCTAGAACCTAGGCTTCTCTGG - Intronic
1020294915 7:6751089-6751111 ATCTAGAACCTAGGCTTCTCTGG + Intergenic
1024668981 7:51574218-51574240 ATTTAGCATCTATGTTCCTCAGG + Intergenic
1028152214 7:87387153-87387175 ATCTAGTACCAATTATCCTCAGG - Intronic
1028747977 7:94349159-94349181 ATATAGGACCTATCTTCATGTGG - Intergenic
1030326056 7:108219422-108219444 TTTTAGCATCTATGTTCCTCAGG - Intronic
1030390139 7:108917765-108917787 TTTTAGGATCTATGTTCATCAGG + Intergenic
1031711652 7:125054371-125054393 ATCTGGGACATATTTTCCCCTGG + Intergenic
1038926743 8:32148962-32148984 ATCCAGGACCTATGTGCTGCAGG + Intronic
1047076451 8:121409498-121409520 AACTAGGATCTTTGGTCCTCTGG + Intergenic
1047175626 8:122537881-122537903 TTCTAGAACATATGTGCCTCTGG - Intergenic
1052276852 9:26686429-26686451 ATCAAGGACCTATGTGCTTGGGG + Intergenic
1053642144 9:40094719-40094741 ATGTAAAACATATGTTCCTCAGG + Intergenic
1053763994 9:41370738-41370760 ATGTAAAACATATGTTCCTCAGG - Intergenic
1054323038 9:63692111-63692133 ATGTAAAACATATGTTCCTCAGG + Intergenic
1054542607 9:66281928-66281950 ATGTAAAACATATGTTCCTCAGG - Intergenic
1056103003 9:83317805-83317827 CTCTAGGACATCTGTTCATCAGG + Intronic
1057573831 9:96224024-96224046 ATCCAAGGCCTATGGTCCTCTGG - Intergenic
1060791939 9:126491266-126491288 ATTTGGGACCTATGTCCCGCAGG + Intronic
1202789906 9_KI270719v1_random:77738-77760 ATGTAAAACATATGTTCCTCAGG + Intergenic
1185537889 X:876676-876698 AGCTAGGATCTATGTGACTCTGG - Intergenic
1191913440 X:66176449-66176471 TTTTAGGACCTATGTTCATCAGG + Intronic
1193438056 X:81503779-81503801 TTCTTGCATCTATGTTCCTCAGG - Intergenic
1193638833 X:83986288-83986310 ATCTAATAGCTATGTTCCTTGGG - Intergenic
1195932752 X:110095725-110095747 AGCGAGGAGCTATGTTCCTTTGG + Intronic
1196163679 X:112514311-112514333 TTCTAGGAGGTATGTTCCACAGG + Intergenic