ID: 976771371

View in Genome Browser
Species Human (GRCh38)
Location 4:88656601-88656623
Sequence TGCAGTAATCCCAATGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976771371 Original CRISPR TGCAGTAATCCCAATGTTGG AGG (reversed) Intronic
901916595 1:12505043-12505065 TGCTGTCATCCCAATCATGGTGG + Intronic
903166437 1:21523721-21523743 TGCAGGCCTCCCCATGTTGGAGG - Intronic
907294629 1:53442425-53442447 TGTTGTAATCCCAGTGTTGGAGG + Intergenic
909133549 1:71768756-71768778 AATTGTAATCCCAATGTTGGAGG + Intronic
909213426 1:72853379-72853401 TTCAGTAATCACATTCTTGGTGG - Intergenic
909448233 1:75771215-75771237 AACTGTAATCCCAGTGTTGGAGG + Intronic
910442698 1:87268860-87268882 TGCACTAATCCTATTGATGGGGG - Intergenic
910593903 1:88958038-88958060 GGCAGTCATCAAAATGTTGGTGG - Intronic
911109539 1:94167694-94167716 TGTATTAATCCCACTGTTGATGG - Intronic
915675422 1:157525639-157525661 TGCAGTAGTCAAAATGATGGTGG + Intronic
916328231 1:163587688-163587710 TGCTGAAATCACAGTGTTGGTGG + Intergenic
916368718 1:164063901-164063923 TGGAATAATCCCAATTTTGCTGG + Intergenic
920273617 1:204787107-204787129 AATTGTAATCCCAATGTTGGAGG + Intergenic
922648208 1:227312724-227312746 AACTGTAATCCCAGTGTTGGAGG + Intronic
922665985 1:227469864-227469886 TGCATAATTCCCAGTGTTGGGGG + Intergenic
923707652 1:236357780-236357802 AACTGTAATCCCCATGTTGGAGG - Intronic
923708230 1:236363291-236363313 AGTAGTAATCCCAATGTAGGGGG + Intronic
1064216423 10:13404506-13404528 AGCAGTCCTCCCAAAGTTGGGGG - Intergenic
1066413037 10:35192306-35192328 TGCAGTAATGGAGATGTTGGGGG - Intronic
1067134939 10:43599612-43599634 AGTTGTAATCCCAGTGTTGGAGG - Intergenic
1067265378 10:44737502-44737524 TGCAGTAGTTCCATAGTTGGAGG + Intergenic
1068760460 10:60702409-60702431 TACAGTAATCATATTGTTGGTGG + Intronic
1072764419 10:98084048-98084070 AGCACTAATCCCATTGATGGGGG + Intergenic
1074152550 10:110770237-110770259 AGCAGTAATTCAAATTTTGGTGG - Intronic
1075327013 10:121541323-121541345 TCCAGCAGTCCCACTGTTGGTGG - Intronic
1077146877 11:1050399-1050421 TGCAGTAAATCCAGTGATGGCGG - Intergenic
1077583309 11:3431730-3431752 TGCAGTAATCACAGTGTTCCGGG + Intergenic
1080572839 11:33571735-33571757 TTGTGTAATCCCAGTGTTGGAGG - Intronic
1082892065 11:58150333-58150355 TCCTATAATCCCAGTGTTGGGGG + Intronic
1084240230 11:67814540-67814562 TGCAGTAATCACAGTGTTCCGGG + Intergenic
1084832207 11:71778304-71778326 TGCAGTAATCACAGTGTTCCGGG - Intergenic
1085859419 11:80214602-80214624 TGTGGCAATCCCAATGCTGGAGG - Intergenic
1091715922 12:2776135-2776157 CGCAGTAATCTCAGTGTTGATGG + Intergenic
1093941927 12:25064773-25064795 TTAAGTACTCCCACTGTTGGTGG - Intronic
1094407109 12:30128197-30128219 TCCAGTATTCCCATTTTTGGAGG + Intergenic
1096001881 12:48137011-48137033 GCCAGTAATCCCAATGTTTTGGG - Intronic
1100608195 12:96169302-96169324 TGCAGTAATCCCAGAGTTTTGGG + Intergenic
1101714678 12:107300483-107300505 TCATGTAATCCCATTGTTGGGGG + Intergenic
1102071924 12:110027351-110027373 TGGAGTAATGGCAATGGTGGTGG - Intronic
1102546461 12:113660412-113660434 GGCTGGAATCCCAAAGTTGGAGG - Intergenic
1103205338 12:119124624-119124646 TGCAGTAACACCACTGTTAGTGG + Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105621811 13:22074995-22075017 TGCAGAATTCTCAATGTTTGTGG - Intergenic
1106868796 13:33996619-33996641 TGCCTTAATCCCAATGTTTCGGG - Intergenic
1111026007 13:82525591-82525613 TGCAGTAAACTCAGTGTTTGTGG + Intergenic
1112756058 13:102634850-102634872 TGCAGTACACCCAAAGATGGAGG - Intronic
1112996158 13:105577433-105577455 TGCAGTAATCCCATTCATGAGGG + Intergenic
1115916431 14:38320650-38320672 AATTGTAATCCCAATGTTGGGGG - Intergenic
1117409795 14:55440451-55440473 GACCGTAATCCCACTGTTGGGGG + Exonic
1119381282 14:74230447-74230469 TGCAGCAAAGCCAAAGTTGGTGG + Intergenic
1119636890 14:76280466-76280488 TGCAAAAGTCCCCATGTTGGGGG - Intergenic
1120771234 14:88382771-88382793 AACTGTAATCCCCATGTTGGGGG + Intergenic
1121884712 14:97532868-97532890 GGCACTAATCCCACTGATGGAGG + Intergenic
1123487186 15:20751857-20751879 TGGAATAATCACAATGTTGCAGG - Intergenic
1123543676 15:21320912-21320934 TGGAATAATCACAATGTTGCAGG - Intergenic
1128172630 15:65526314-65526336 TGCTGTAATCCCAATGCTTTGGG - Intergenic
1128227430 15:66011972-66011994 GGCTGTAATCCCAATGCTGTGGG + Intronic
1128524529 15:68403302-68403324 AACAGGATTCCCAATGTTGGAGG + Intronic
1128668993 15:69560199-69560221 TGCTGTAATCCCATTGTTTATGG + Intergenic
1128752915 15:70161770-70161792 TCCAGTAATTCCCATGTGGGAGG + Intergenic
1128786736 15:70403256-70403278 TGCAGCCATTCCTATGTTGGGGG - Intergenic
1128788029 15:70412621-70412643 TCCAGGAATGCCAATGCTGGGGG + Intergenic
1129481835 15:75832734-75832756 GTCAGTTATCCCAATCTTGGAGG - Intergenic
1131502745 15:92985659-92985681 TGCAGAGATCCGAAGGTTGGTGG + Exonic
1202951993 15_KI270727v1_random:48038-48060 TGGAATAATCACAATGTTGCAGG - Intergenic
1133864103 16:9625839-9625861 TGCAGTAATCCCAGGGTTTTGGG - Intergenic
1134758458 16:16691126-16691148 AATTGTAATCCCAATGTTGGAGG + Intergenic
1134987614 16:18668052-18668074 AATTGTAATCCCAATGTTGGAGG - Intergenic
1139164163 16:64546466-64546488 TGCAGTAATCCTGGAGTTGGTGG - Intergenic
1139620789 16:68140242-68140264 GCCAGTAATCCCAACGTGGGCGG - Intronic
1143700179 17:8653279-8653301 TTCAGTAATCATATTGTTGGTGG + Intergenic
1145783812 17:27581309-27581331 AATTGTAATCCCAATGTTGGAGG - Intronic
1157467821 18:47962930-47962952 CCCTATAATCCCAATGTTGGAGG + Intergenic
1158752640 18:60281630-60281652 TGCAGAAAACCCAATGTTTCAGG - Intergenic
1158920819 18:62188531-62188553 AGCAGAAAACCCAATTTTGGCGG - Intronic
1160039795 18:75335174-75335196 TGCAGTCATGCCAATGGTGCAGG + Intergenic
1160071678 18:75634662-75634684 AATTGTAATCCCAATGTTGGGGG + Intergenic
1161813481 19:6484521-6484543 GGCATTAATCCCACTGTTGAGGG - Intergenic
1163959115 19:20670741-20670763 TGCAGTAAGAACAATGTTGTGGG + Intronic
1164749447 19:30641666-30641688 TGCAGTAATTCCATTTCTGGTGG - Intronic
1164772315 19:30819102-30819124 TGCAGTCAGACCAATGCTGGGGG - Intergenic
1168374390 19:55863605-55863627 AACTGTAATCCCAGTGTTGGAGG - Intronic
930830028 2:55733104-55733126 AGCAGTAATTCCAATGCGGGTGG - Intergenic
933846303 2:86329718-86329740 TCCAGTAATGCCAATGCTGCTGG + Intronic
934861472 2:97766990-97767012 TTCAGGAATCCCACTGGTGGTGG - Intronic
935675685 2:105593391-105593413 GGAAGCAATCCCTATGTTGGTGG + Intergenic
936396712 2:112137308-112137330 GGCACTAATCCCAATTTTGAGGG - Intergenic
936865827 2:117075505-117075527 TATAGTAATCATAATGTTGGTGG - Intergenic
938222020 2:129577520-129577542 TACAGTAATCATATTGTTGGAGG - Intergenic
938558680 2:132450300-132450322 AGCAGAAAGCTCAATGTTGGTGG - Intronic
941154842 2:161963755-161963777 TCCAGGAATCCCAATGTTGAGGG + Intronic
944858781 2:203794245-203794267 TGCAGCAATCCCAACTGTGGAGG + Intergenic
945447826 2:209959275-209959297 TGTAGTAAACCCACTTTTGGGGG - Intronic
947430293 2:230021948-230021970 TCCTGTAATCCCAGTGTGGGAGG - Intergenic
947997325 2:234539371-234539393 TGCAGTAATCTCAGCGTTTGAGG - Intergenic
948546475 2:238733991-238734013 TGCCTTGATCCCAATTTTGGGGG + Intergenic
948861051 2:240752732-240752754 TGCAAAAATCCCAGGGTTGGAGG + Intronic
1170390201 20:15864854-15864876 TGCAGAAATCACAATTTTTGAGG - Intronic
1171221164 20:23399243-23399265 TCCAGTAATACAAATTTTGGGGG - Intronic
1172458375 20:35095426-35095448 TGCTGTAATCCCAATGTCAGTGG + Intergenic
1177688932 21:24477885-24477907 TGCAGTAATACCAGTGAAGGTGG - Intergenic
1177855831 21:26399330-26399352 TGCAGCTATTCCAATGATGGTGG + Intergenic
1178289701 21:31356531-31356553 AGCACTAATCCCAATCCTGGGGG - Intronic
1178793591 21:35722783-35722805 TGCAGCAATAACAATTTTGGAGG + Intronic
1179176085 21:39009321-39009343 TTCAGTAATCCCCATCCTGGGGG + Intergenic
1180628360 22:17209668-17209690 TCCAGGCATCCCGATGTTGGTGG - Exonic
1184674441 22:46032792-46032814 AGCAGGAACCCCACTGTTGGGGG - Intergenic
951424316 3:22525586-22525608 GGCATTAATCCCAATCTTGAGGG + Intergenic
952697134 3:36279125-36279147 AATTGTAATCCCAATGTTGGAGG - Intergenic
953120731 3:40039002-40039024 TGAAGGAATCCCAAAGGTGGTGG + Intronic
953772789 3:45791868-45791890 AATTGTAATCCCAATGTTGGAGG - Intronic
954767906 3:52937214-52937236 TTTAGTAATCCTACTGTTGGTGG - Intronic
961298690 3:125907393-125907415 TGCAGTAATCACAGTGTTCCGGG - Intergenic
961631562 3:128303063-128303085 TGCAGTAATCACAATTTTTAAGG - Intronic
961922388 3:130441338-130441360 TGCAGTAATGTCAATGCTGCTGG + Intronic
962202070 3:133409177-133409199 TTCAGTAATCACATTGGTGGTGG + Intronic
962220727 3:133562618-133562640 TGCTGTAATCCCAATGCTTTGGG - Intergenic
962517151 3:136162869-136162891 TTCAGTAACCACACTGTTGGCGG + Intronic
963094133 3:141517576-141517598 AACTGTAATCCCACTGTTGGAGG - Intronic
963245952 3:143062978-143063000 TGTAATATTCCCAGTGTTGGAGG + Intergenic
964718909 3:159752226-159752248 TGCAATAATCACAAGATTGGTGG - Intronic
969815384 4:9683323-9683345 TGCAGTAATCACAGTGTTCCGGG - Intergenic
970998916 4:22300735-22300757 TGCAATATTCCCAAAGTTGAGGG - Intergenic
973215817 4:47667959-47667981 GGCACTAATCCCATTCTTGGGGG - Intronic
975623764 4:76321395-76321417 TGCAGTAATCCCACTACTGGAGG + Intronic
975872868 4:78800462-78800484 TTCAGTAATACAAATTTTGGTGG + Intronic
976771371 4:88656601-88656623 TGCAGTAATCCCAATGTTGGAGG - Intronic
977217726 4:94301714-94301736 TTCAGTAATCATATTGTTGGTGG - Intronic
981595910 4:146421595-146421617 TGGAGTAAGCCCATTCTTGGTGG - Intronic
983434883 4:167700236-167700258 TGCAGTAACTGCAATGTTTGAGG - Intergenic
984597551 4:181687806-181687828 AGCAGTTAGCCTAATGTTGGAGG - Intergenic
986548433 5:8924985-8925007 TGCAATAGTCCCAGTGGTGGTGG + Intergenic
986924779 5:12733059-12733081 ATGAGTAATCCCCATGTTGGGGG + Intergenic
987059668 5:14230413-14230435 TGCAGTTGTCACAATGATGGGGG - Intronic
987717381 5:21589742-21589764 TGAAGTAATACAAATGTTGCTGG + Intergenic
988659525 5:33250208-33250230 TGCAGTAATCTGGATGATGGTGG + Intergenic
991008011 5:61850375-61850397 TGAAATTATCCCAGTGTTGGAGG + Intergenic
994267100 5:97730459-97730481 TGCAGTAATTCCGGTGGTGGTGG - Intergenic
994372419 5:98982484-98982506 TGCAATAATCACAATAATGGTGG + Intergenic
995091665 5:108185259-108185281 AATTGTAATCCCAATGTTGGAGG + Intronic
995170993 5:109111835-109111857 TACATAATTCCCAATGTTGGGGG - Intronic
998943886 5:147316087-147316109 TTCAGTAATGGCATTGTTGGGGG + Intronic
1000686947 5:164262184-164262206 AACTGTAATCCCCATGTTGGAGG + Intergenic
1003043358 6:2710237-2710259 AGCTTTAATACCAATGTTGGGGG - Intronic
1003113567 6:3268300-3268322 TGGAGTAATCCCCACCTTGGTGG + Intronic
1003349615 6:5303655-5303677 TGCAATAATCACAAAGATGGAGG - Intronic
1003486715 6:6586561-6586583 TGCAATAAAGCCAATGTTTGTGG + Intergenic
1004001879 6:11603646-11603668 AGCAGTCATCCCAATGCAGGTGG - Intergenic
1004509064 6:16269974-16269996 GCCACTAATCCCATTGTTGGGGG + Intronic
1007383886 6:41507594-41507616 TACAGCAATCCCAAACTTGGCGG - Intergenic
1007920380 6:45603950-45603972 TCCAGTAATCCCCATGTTCATGG - Intronic
1008716428 6:54295301-54295323 TGCATTCACCCCAATGGTGGTGG + Intergenic
1009669496 6:66729243-66729265 AAATGTAATCCCAATGTTGGAGG + Intergenic
1010726304 6:79337591-79337613 GGCACTAATCCCAATCTTGAGGG - Intergenic
1010903596 6:81457898-81457920 GGCAGTAATCCCACTCTTGAGGG - Intergenic
1014725714 6:124969515-124969537 TGCAGTTATCCCAAAATTGGTGG - Intronic
1015885955 6:137918898-137918920 TGCAGTAATTCTCATGGTGGGGG - Intergenic
1016492840 6:144626594-144626616 GGCAGCAATCTCAGTGTTGGGGG - Intronic
1016822098 6:148356446-148356468 TGCAGCAATCCCACTCCTGGGGG - Intronic
1017992210 6:159500780-159500802 TGTAGTAAGCTCAATGTTGCAGG - Intergenic
1018575947 6:165260040-165260062 AATTGTAATCCCAATGTTGGAGG - Intergenic
1023409396 7:39874405-39874427 TGCAGTCAATCAAATGTTGGGGG + Intergenic
1023782917 7:43674644-43674666 TGATGTAATCCTAAAGTTGGAGG + Intronic
1024548540 7:50541530-50541552 GGCACTAATCCCACTGTTGGGGG - Intronic
1025986522 7:66457741-66457763 TGCACTAATCCCAATCATGAGGG + Intergenic
1026003116 7:66578650-66578672 TGCACTAATCCCAATCATGAGGG + Intergenic
1026505037 7:70975207-70975229 AATTGTAATCCCAATGTTGGAGG - Intergenic
1027183627 7:75956532-75956554 GGCAGTATTCCCAATCTTGTGGG + Intronic
1027209790 7:76136593-76136615 TGCACTAATCCCAATCATGAGGG + Intergenic
1027444023 7:78251881-78251903 TCCTGTAATCCCAACTTTGGCGG + Intronic
1028645771 7:93094782-93094804 ATCTGTAATCCCAATGTTTGAGG - Intergenic
1029743515 7:102504365-102504387 TCCAGTAATCCCAATGCTTTGGG - Intronic
1029761503 7:102603524-102603546 TCCAGTAATCCCAATGCTTTGGG - Intronic
1030113114 7:106043011-106043033 TGCAGAAATGGCAAGGTTGGTGG + Intergenic
1036658671 8:10693567-10693589 TACACAAATCCCAATGCTGGGGG + Intronic
1036850835 8:12200159-12200181 TGCAGTAATCACAGTGTTCCGGG + Intergenic
1036872199 8:12442437-12442459 TGCAGTAATCACAGTGTTCCGGG + Intergenic
1040781124 8:51110678-51110700 AGCAGTAATCCCAATCATGAAGG - Intergenic
1044288755 8:90442358-90442380 TGTTGTAATTCTAATGTTGGGGG - Intergenic
1045196720 8:99939970-99939992 TGCACTGATCCCAATCTTAGGGG + Intergenic
1045239187 8:100384044-100384066 TCCTGTAATTCCAATGCTGGTGG + Intronic
1050856677 9:10366089-10366111 TGCTGTGGTCCCAATGTAGGTGG + Intronic
1051037025 9:12760222-12760244 TGTAGAAATCCTAATTTTGGAGG + Intergenic
1053756650 9:41318529-41318551 TGCTGGAATCCCTATGTTGTGGG + Intergenic
1055496704 9:76861977-76861999 TCCAGTCATCCCACTGTTGTGGG + Intronic
1056003900 9:82246981-82247003 AACTGTAATCCCAATGTTGGAGG + Intergenic
1060467188 9:123917361-123917383 TTCAGTAATCGCATTGTTGACGG + Intronic
1190615763 X:52229152-52229174 TGCAGTAGTCCCATAGTTTGAGG - Intergenic
1190657006 X:52621481-52621503 TCCTGTAATCCCAATGTTTTGGG + Intergenic
1192625563 X:72723856-72723878 TGTAGTAATCACATTTTTGGTGG - Intergenic
1193642487 X:84028116-84028138 TGCTGTAATTCCAGTGTTTGGGG - Intergenic
1194242997 X:91474629-91474651 AATTGTAATCCCAATGTTGGAGG - Intergenic
1194509452 X:94775003-94775025 TGCATTATTTCCAATGTTGGAGG + Intergenic
1199063734 X:143389520-143389542 AATTGTAATCCCAATGTTGGGGG + Intergenic
1201352630 Y:13061610-13061632 TGCAGTAATCCCAGCATTTGGGG + Intergenic