ID: 976774826

View in Genome Browser
Species Human (GRCh38)
Location 4:88697258-88697280
Sequence GCTGCGGCAGAGGCTGCCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 945
Summary {0: 1, 1: 0, 2: 5, 3: 70, 4: 869}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976774826 Original CRISPR GCTGCGGCAGAGGCTGCCGC GGG (reversed) Exonic
900601531 1:3504812-3504834 CCGGCAGCAGAGGCTGCCCCTGG - Intronic
900970131 1:5987465-5987487 GGTGGGGCAGAGGCAGCAGCAGG + Intronic
901042290 1:6372114-6372136 GCTGCTGGAGAAGCTGCAGCAGG - Intronic
901045471 1:6393311-6393333 GCTGCGGCGGCGGATGCGGCGGG + Intronic
901098457 1:6701513-6701535 GCTGGGGCGGAGGCTGGCCCCGG + Intronic
901324478 1:8358559-8358581 GCTGCGGGAGAGGATGAAGCCGG - Exonic
901436676 1:9250903-9250925 TCTGGGCCAGAGGCTGCAGCAGG - Intronic
901447972 1:9319647-9319669 GCTGGTGCAGAGGATGCTGCGGG + Intronic
901462801 1:9401490-9401512 GCTGAGGCAGAGGTTGACGAAGG + Intergenic
902509541 1:16958696-16958718 CCTCCGGCAGAGGCTGCTGAAGG + Exonic
902577393 1:17386847-17386869 GCTGCGGCCGTGGCTGCCCCTGG - Intronic
902583841 1:17426087-17426109 GCTGAGGAAGAGGCTGACCCAGG + Intronic
902819341 1:18934177-18934199 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
903907688 1:26697433-26697455 GCTGCGGCGGCGGCCGCCTCGGG + Exonic
903909880 1:26715759-26715781 GCTACTGCAGAGGCTGAGGCAGG + Intronic
903983209 1:27204956-27204978 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
904130709 1:28273408-28273430 GCTGCAGGAGAGCCTGCTGCGGG + Exonic
904215381 1:28914725-28914747 GCTGCAGCAGTGGCGGGCGCAGG + Intronic
904277409 1:29393478-29393500 GCTGGGACAGAGGCTGTTGCAGG + Intergenic
904458674 1:30662670-30662692 GCTTAGGCAGAGGCTCCTGCAGG + Intergenic
905017312 1:34786487-34786509 GCTGTGGCTGTGGCTGCAGCTGG + Intronic
905090067 1:35423569-35423591 GCTGCTTCAGAGGCTGATGCAGG + Intergenic
905804968 1:40869615-40869637 GCTGCTGGAGAGGCTGGGGCAGG + Intergenic
905920319 1:41714942-41714964 GCTGGGGCAGATGGTGCCGGAGG - Intronic
906590984 1:47023919-47023941 GCGGAGGCAGCGGCTGCTGCGGG + Exonic
906746979 1:48228904-48228926 GCTGGGACAGGGGCTGCCGGAGG + Exonic
907049212 1:51318360-51318382 GCTGCGGCTGGGCCTGCCTCAGG + Intronic
907242851 1:53090321-53090343 GATGCGGCTGAGGCTGACGGAGG - Intronic
910441825 1:87260836-87260858 GATGCAGCAGTGGCTGCTGCTGG + Intergenic
910549738 1:88462724-88462746 GCTGCCGCTGGGGCTGCCGCGGG + Intergenic
910760953 1:90730527-90730549 GCTGCGGTTGCGGCTGCGGCGGG - Intergenic
911152737 1:94610721-94610743 GCTGTTGCAGAGGCTGAGGCAGG - Intergenic
912400481 1:109387379-109387401 GCTACTGCAGAGGCTGAGGCAGG + Intronic
912802645 1:112730141-112730163 GCTGAGGCAGAGGCTGGCAGTGG - Intergenic
912876801 1:113368196-113368218 GCTGAGGTAGAAGCTGCCTCAGG + Intergenic
912950312 1:114116249-114116271 GCTGCAGCAGACACTGCCTCAGG + Intronic
912993498 1:114511145-114511167 GCTGCGGCTGCGGCTGGGGCTGG - Exonic
913280712 1:117182492-117182514 GCAGCCGCAGGGGCTGCAGCCGG - Intronic
913937232 1:125065896-125065918 GCTGCAGCAGAAGTTGCCTCAGG - Intergenic
914518358 1:148393363-148393385 GCTGCTGGGGAGGCTGACGCAGG + Intergenic
914747554 1:150511143-150511165 GCTGCGGCAGTGGCAGCAGCGGG - Exonic
914759151 1:150584620-150584642 GCTACTGCAGAGGCTGTGGCAGG + Intergenic
914869161 1:151458950-151458972 CCCGCGGCAGGGGCGGCCGCGGG - Intronic
915167860 1:153958534-153958556 GCCGCGGCGGAGGCCGCGGCTGG - Exonic
915434871 1:155896663-155896685 GCTACTGAAGAGGCTGACGCAGG + Intergenic
915749767 1:158195692-158195714 GCTGAGGCTGAGGCTGGGGCTGG - Intergenic
915911486 1:159918310-159918332 GCTGGGGCAGCAGCTGCCACAGG + Exonic
916069053 1:161159563-161159585 GCTGCGGCTAAAGCTGCAGCCGG + Exonic
916701678 1:167302181-167302203 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
917817443 1:178725271-178725293 GCGGCGGCGGCGGCTGCTGCGGG + Exonic
917877360 1:179297888-179297910 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
917884751 1:179372793-179372815 GCTACGTCAGAGGCTGAGGCAGG - Intronic
919101786 1:193105264-193105286 GCTGCGGCAGCTGCGGCCTCTGG - Intronic
919101979 1:193106515-193106537 GCTGCGGCAGCTGCGGCCTCTGG - Intergenic
919310975 1:195908811-195908833 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
919651572 1:200154605-200154627 GCTACTGCAGAGGCTGAGGCAGG + Intronic
919712288 1:200739630-200739652 GCGGCGGCGGCGGCTCCCGCGGG + Exonic
920213295 1:204344486-204344508 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
920676941 1:208044629-208044651 GATGAGGAGGAGGCTGCCGCCGG + Exonic
921067976 1:211636367-211636389 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
921189850 1:212699678-212699700 GCTGCGGCTGCGGCTGCGGCTGG + Exonic
921229206 1:213051382-213051404 GCGGCGGCAGAGGCGGCGGGAGG + Exonic
921466772 1:215497676-215497698 GCAGCAGCAGAGGCAGCAGCAGG + Intergenic
921891318 1:220356802-220356824 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
922315082 1:224434686-224434708 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
922335592 1:224616341-224616363 GCGGCGGCAGCGGCAGCAGCAGG + Exonic
922808113 1:228401092-228401114 GCTGCTGCAGAGGCTGGAGGAGG - Exonic
923249581 1:232167489-232167511 GCTACTTCAGAGGCTGACGCAGG + Intergenic
923662414 1:235969642-235969664 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
924527432 1:244864403-244864425 GCGGCGGCTGCGGCTGCGGCTGG + Exonic
924608274 1:245553423-245553445 GCTGTGGCGGAGGCTGAGGCTGG + Intronic
924665708 1:246069732-246069754 CCTGAGGCAGAGGCAGCAGCAGG + Intronic
924723342 1:246644275-246644297 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
924795833 1:247291616-247291638 GCTGCAGCAGAGGCTCAGGCAGG - Intergenic
1062899573 10:1132723-1132745 GCTGGGGCTGAGGCTGAGGCTGG + Intergenic
1063112552 10:3049360-3049382 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1063367295 10:5499090-5499112 GCTGGGGCAGCCGCTGCCGCAGG - Exonic
1063468218 10:6262340-6262362 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1063570745 10:7212505-7212527 GCTGGAGCACAGGCTCCCGCAGG + Intronic
1064018028 10:11787809-11787831 GCTGAGACTGAGGCTGCAGCAGG - Intergenic
1064427770 10:15245175-15245197 GCTACGCCAGAGGCTGAGGCAGG - Intronic
1064587118 10:16850581-16850603 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1064671034 10:17713964-17713986 GCTGCGGCAGAGGGGGCCGCAGG - Intronic
1065023084 10:21516867-21516889 GCGGCGGCGGCGGCCGCCGCGGG - Exonic
1065286828 10:24194693-24194715 GCTACTGCAGAGGCTGAGGCAGG - Intronic
1065326829 10:24556872-24556894 GCTGGGCCAGAGGGAGCCGCGGG - Intergenic
1065727954 10:28684436-28684458 GCTGCTTCAGAGGCTGAGGCAGG - Intergenic
1066121249 10:32289733-32289755 GCTGCTTCAGAGGCTGAGGCAGG - Intronic
1066643046 10:37575571-37575593 GCTACGCCAGAGGCTGTAGCAGG + Intergenic
1067486671 10:46656967-46656989 GCTACGCCAGAGGCTGAGGCAGG + Intergenic
1067608080 10:47684695-47684717 GCTACGCCAGAGGCTGAGGCAGG - Intergenic
1068070256 10:52185658-52185680 GCCGAGGCAGAAGCTGCCACAGG - Intronic
1069473760 10:68715438-68715460 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1069486628 10:68827818-68827840 GCTGCGGCGGGGGGTGCTGCTGG + Exonic
1069486715 10:68828154-68828176 GCTGCGGCGGGGGGTGCTGCTGG + Intronic
1069518272 10:69097370-69097392 GCTGCTCCAGAGGCTGAAGCAGG - Intronic
1069598271 10:69686751-69686773 GCTTCTCCAGAGGCTGCAGCTGG - Intronic
1069846629 10:71376873-71376895 GCTGAGGCAGAGGCAGAGGCAGG - Intergenic
1070147049 10:73782120-73782142 GCTTCAGCACAGGCTTCCGCGGG - Exonic
1070224759 10:74491352-74491374 GCTGCTTGAGAGGCTGACGCAGG - Intronic
1070352953 10:75611051-75611073 GCTGCTGCAGAGGCTGGAGCTGG + Intronic
1070809857 10:79292234-79292256 GCTGCTGCAGCGGCTGCCGCGGG - Exonic
1070982740 10:80662850-80662872 GCTGCTCAAGAGGCTGCCGTGGG - Intergenic
1071086887 10:81875422-81875444 GCTGCGGCGGCGGCAGCGGCGGG + Exonic
1071919415 10:90332417-90332439 ACAGCTGCAGAGGCTGCAGCAGG + Intergenic
1072003567 10:91220814-91220836 GCGGCGGCGGTGGCGGCCGCTGG + Intronic
1072435923 10:95414705-95414727 GAGGCGGCAGAGGCAGTCGCTGG + Exonic
1072961543 10:99933846-99933868 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1073288428 10:102401889-102401911 GCTGCGCAGGAGGCTGCCACTGG - Exonic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1073413275 10:103360074-103360096 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1073413504 10:103362255-103362277 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1073875292 10:107915024-107915046 GCGTGGGCAGGGGCTGCCGCAGG + Intergenic
1074324139 10:112431423-112431445 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1074535860 10:114328351-114328373 GCTGCTGCAGGTGCTGCTGCAGG + Intronic
1074760699 10:116665291-116665313 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1074778187 10:116781559-116781581 GCTGTGGCAGAGGCTGCCCTTGG - Intergenic
1074821714 10:117184489-117184511 GCTACCTCAGAGGCTGGCGCTGG - Intergenic
1075193776 10:120336206-120336228 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1076485410 10:130812575-130812597 GATGCGTCAGAGGCCGCTGCTGG + Intergenic
1076704506 10:132293838-132293860 GCTGGGGCAGAGCCTGCTCCGGG + Intronic
1076886381 10:133264674-133264696 GATGGGGCTGAGGCTGCAGCAGG - Intronic
1076886388 10:133264713-133264735 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886404 10:133264793-133264815 GGTGGGGCAGAGGCTGCAGCAGG - Intronic
1076886415 10:133264833-133264855 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886423 10:133264872-133264894 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886432 10:133264912-133264934 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886439 10:133264952-133264974 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886447 10:133264991-133265013 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886457 10:133265031-133265053 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886466 10:133265071-133265093 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886474 10:133265110-133265132 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886483 10:133265150-133265172 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886492 10:133265190-133265212 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886501 10:133265230-133265252 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886511 10:133265270-133265292 GATGGGGCAGAGGCTGCAGCAGG - Intronic
1076886521 10:133265310-133265332 TATGGGGCAGAGGCTGCAGCAGG - Intronic
1077480539 11:2812482-2812504 GCCCCGGCAGAGGCTGCAGTAGG - Intronic
1077538710 11:3136411-3136433 GCTGAGGCAGTGTCTGCCCCTGG - Intronic
1078561586 11:12377625-12377647 GGCGCGGCGCAGGCTGCCGCGGG - Exonic
1078685026 11:13521483-13521505 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1078822038 11:14892094-14892116 GCTGAAGCAGAGGCGGCCGATGG - Exonic
1079432299 11:20404343-20404365 GCTACTCCAGAGGCTGACGCAGG - Intronic
1080012422 11:27472317-27472339 GCCGCGGGAGAGGCCGGCGCGGG - Exonic
1081574302 11:44309744-44309766 GCTGCGGCTGCGGCGGCGGCTGG + Exonic
1081705612 11:45180759-45180781 GCTGCGGCCGGGGCGGGCGCGGG - Intronic
1082698562 11:56401003-56401025 GCTGCTCCAGAGGCTGAAGCAGG - Intergenic
1083303125 11:61749095-61749117 GCTGGGGCAGAGGCTGGGGCAGG - Intergenic
1083511135 11:63210378-63210400 GCTGAGGCAGAGGCTGAGGAAGG + Intronic
1083572627 11:63768566-63768588 GCGGCGGCAGGGGCGGCCCCGGG - Exonic
1083970364 11:66070570-66070592 GCTGCGGCGGCGGCTGCTGAGGG - Exonic
1084001144 11:66295980-66296002 CCTGCAGCAGAGGCTGCCTGTGG + Exonic
1084002421 11:66303956-66303978 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1084072242 11:66744319-66744341 TCTGCGGCGGGGGCTGCCCCAGG - Intergenic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1085332958 11:75668222-75668244 GCGGCGGCGGTGGCTGCGGCGGG + Exonic
1085623845 11:78057114-78057136 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1086101996 11:83110514-83110536 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1087327190 11:96738569-96738591 CCTCAGGCAGAGGCTGCTGCTGG + Intergenic
1087470727 11:98571004-98571026 GGTGGGGCAGAGGCTGCAGTGGG - Intergenic
1087946283 11:104164203-104164225 GCTGCAGCACAGGCTGCAGGGGG + Intronic
1088121472 11:106375467-106375489 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1088182749 11:107130277-107130299 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1089255169 11:117190309-117190331 GCTGGAGCTGAGGCTGCGGCAGG - Intronic
1089426131 11:118376939-118376961 GCTGCTTCAGAGGCTGAGGCAGG + Intronic
1089541829 11:119193817-119193839 GCTGAGGCAGAGGCTGCAAGGGG - Exonic
1089699391 11:120235306-120235328 GCTGAGGCAGAGGCTGAGGCTGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090037607 11:123262361-123262383 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1090252119 11:125258891-125258913 GCTGAGGCTGAGGCTGCAGCAGG - Intronic
1090329745 11:125921775-125921797 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1090832337 11:130428217-130428239 GCTGCTGCTGCTGCTGCCGCTGG - Exonic
1091274714 11:134342454-134342476 GCCACGGGAGAGGCTGCTGCTGG - Intronic
1092095871 12:5841571-5841593 GCAGGGGCTGAGGCTGCCGAGGG - Intronic
1092169352 12:6363568-6363590 GGTGCGGCAGAGTCCCCCGCAGG + Exonic
1092247953 12:6873638-6873660 GCTGCGGCAGAGTCCGCACCCGG + Intronic
1092274591 12:7049580-7049602 GCTACGCCAGAGGCTGAGGCAGG - Intronic
1092370260 12:7911116-7911138 GCTGCTACAGAGGCTGAGGCAGG - Intergenic
1092957498 12:13563587-13563609 GCTGCGGCAGAAGTTGCCCCCGG + Exonic
1093025634 12:14242851-14242873 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1093435340 12:19129743-19129765 GCTGCCGCCGCGGCTGCCGAGGG - Intronic
1093896960 12:24584408-24584430 TCTGCAGCAGAGCCTGCAGCGGG + Intergenic
1094041032 12:26122310-26122332 GCGGCTGCCGCGGCTGCCGCCGG + Exonic
1095038459 12:37419249-37419271 GCTGCAGCCGAGGCGGCAGCTGG + Intergenic
1095049499 12:37543696-37543718 GCTGCCGCGGAGGCTGCAGCAGG + Intergenic
1095741461 12:45611234-45611256 GCCGGGGCTGAGGCTGGCGCTGG + Intergenic
1096240082 12:49955311-49955333 GCGGCCGCAGAGTGTGCCGCCGG + Intronic
1096314974 12:50556652-50556674 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1096831464 12:54317657-54317679 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1096878279 12:54647132-54647154 CCTGGGGCAGAGGCGGCCTCTGG + Exonic
1097052375 12:56231087-56231109 GCTGCAGTAGGGGCTGCTGCTGG + Intronic
1097092300 12:56516450-56516472 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1097112587 12:56672380-56672402 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1097144293 12:56929429-56929451 GCTTTGGGAGAGGCTGCCTCAGG - Exonic
1097232825 12:57522735-57522757 GCTGCCGCAGCCGCCGCCGCAGG - Exonic
1097675978 12:62603067-62603089 CATCCCGCAGAGGCTGCCGCCGG - Exonic
1098607102 12:72404318-72404340 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1098893208 12:76030757-76030779 GTTGCGGCTGAGGCTGAGGCTGG + Exonic
1099070152 12:78036215-78036237 GCTGCTGCAGTGGATGCTGCTGG - Intronic
1099202160 12:79690200-79690222 GCTGCCGCCGAGGCCGCTGCTGG + Exonic
1099547269 12:84000241-84000263 GCTACGCCAGAGGCTGAGGCAGG + Intergenic
1099550146 12:84033413-84033435 GCTCCGTGAGAGGCTGCAGCTGG - Intergenic
1100181235 12:92088394-92088416 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1101870431 12:108561203-108561225 GCTGAGGCAGAAGCTGCCCGCGG + Exonic
1102099912 12:110270316-110270338 GCTGAGGCTGAGGCAGCCGTGGG - Intergenic
1102770093 12:115468331-115468353 GCTGTGGCAGAGGCAGCCTTAGG - Intergenic
1103078783 12:118006714-118006736 GCTACGCCAGAGGCTGAGGCAGG + Intergenic
1103407701 12:120687347-120687369 GCTGCTGCTGCTGCTGCCGCCGG + Exonic
1103563618 12:121804767-121804789 GCTGCGGCGGGGGCTGCTGGTGG - Exonic
1103721244 12:122976671-122976693 GCGGCGGCAGCGGCTGGGGCAGG + Exonic
1104036637 12:125102160-125102182 GCTACTTCAGAGGCTGACGCAGG - Intronic
1104215493 12:126728976-126728998 GCTGCAGAAGAGGCTGCCAAAGG - Intergenic
1104600520 12:130150324-130150346 GCTTTGGCAGAGGCTGGCTCTGG - Intergenic
1104947150 12:132420901-132420923 GCTGCAGAAGAGGCTGCGTCAGG + Intergenic
1104989567 12:132618322-132618344 GCTGCGGCGGAGGCAGGAGCTGG + Intergenic
1105209394 13:18249013-18249035 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1105459421 13:20569459-20569481 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1105866846 13:24468514-24468536 GCTACTGGAGAGGCTGCAGCAGG - Intronic
1106036915 13:26051742-26051764 GCGGCGGCCGCGGCTGCTGCTGG + Intergenic
1106043597 13:26117183-26117205 GCTACTCCAGAGGCTGACGCAGG - Intergenic
1106674691 13:31945906-31945928 GCTGTGACGGTGGCTGCCGCTGG + Intergenic
1107548963 13:41457735-41457757 CCTGCGGCCGCGGCGGCCGCGGG - Exonic
1108372157 13:49780830-49780852 GCTGCTTCAGAGGCTGAGGCAGG - Intronic
1108607392 13:52053187-52053209 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1108662738 13:52601147-52601169 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1108932416 13:55843096-55843118 TCTGTGGCAGAGACTGCAGCAGG + Intergenic
1109139110 13:58691531-58691553 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1110565635 13:76955013-76955035 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1111066650 13:83102353-83102375 GCTGAGGCAGACGCTGAGGCAGG + Intergenic
1111926638 13:94469961-94469983 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1112324029 13:98431571-98431593 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1112456039 13:99565134-99565156 GCTGCTCCAGAGGCTGAGGCCGG - Intergenic
1112680038 13:101753689-101753711 GCTACTGCAGAGGCTGAAGCAGG + Intronic
1113377930 13:109782234-109782256 GCGGCGGCGGCGGCTGCGGCTGG + Exonic
1113378588 13:109784640-109784662 GATGCGGCAGAGGCGGGTGCGGG + Exonic
1113378630 13:109784815-109784837 GCGGCGGCTGCGGCGGCCGCGGG - Exonic
1113378662 13:109784918-109784940 GCGGCGGGAGCGGCGGCCGCGGG - Exonic
1113595608 13:111529774-111529796 GATACGGCACAGGCGGCCGCAGG - Intergenic
1113656167 13:112068756-112068778 GCTGCGGCAGCGAGTGCAGCCGG - Exonic
1113889961 13:113730535-113730557 GCAGCCGCAGAGGCTGTCACGGG - Intronic
1114226302 14:20741748-20741770 GCTGGGTCAGAGGCTGCCCTCGG - Intronic
1114267987 14:21083870-21083892 GCTGTTCCAGAGGCTGCTGCAGG - Exonic
1114551153 14:23533507-23533529 GCTGCACCAGGGGCTGCCGCTGG - Exonic
1114952068 14:27767413-27767435 GCTACTGCAGAGGCTGAAGCAGG - Intergenic
1115787982 14:36847721-36847743 GCTGCAGCAGAGGGTGCCTGGGG + Intronic
1116167423 14:41350813-41350835 ACTGAGGCAGAAGGTGCCGCAGG + Intergenic
1116444597 14:44994216-44994238 GCTGAGACAGAGGCTGAGGCAGG - Intronic
1116847596 14:49879617-49879639 GCTACTCCAGAGGCTGCGGCGGG - Intergenic
1116991846 14:51285477-51285499 GCTATGGCTGAGGCTGCAGCTGG - Intergenic
1117684768 14:58241627-58241649 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
1118612987 14:67555833-67555855 GCTGGAGCAGAGGCTGCTGGAGG + Exonic
1118688699 14:68317190-68317212 GCTGCTGCAGAACCTGCCTCAGG + Intronic
1118849483 14:69573096-69573118 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1119300404 14:73566913-73566935 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1119390631 14:74288998-74289020 GCTACGGAAGAGGCTGAGGCAGG + Intronic
1119730423 14:76947567-76947589 GCTTTGGCAAAGGCTGCAGCAGG - Intergenic
1120789184 14:88563356-88563378 GCTGCGGCTGAAGTAGCCGCCGG + Intronic
1121137327 14:91510391-91510413 ACTGCGGCGGAGGCTTCCGACGG + Intronic
1122203688 14:100137680-100137702 GGTGGGGCAGAGGCGGGCGCTGG + Intronic
1122205770 14:100147225-100147247 GCTGTGGCAGAGGCACCCACGGG + Intronic
1122418454 14:101561234-101561256 ACTCCGGCAGCCGCTGCCGCTGG - Intergenic
1122445018 14:101761786-101761808 GCGGCGGCGGCGGCGGCCGCGGG + Exonic
1122582116 14:102777541-102777563 GCGGCCGCCGCGGCTGCCGCCGG - Exonic
1122657764 14:103273642-103273664 GGTGCGGCAGAGGCGTCCGCTGG - Intergenic
1122727044 14:103763102-103763124 GCTGCGGGAAAAGCTGCTGCAGG - Intronic
1122743121 14:103883128-103883150 GCAGCGGCAGGGGCTGCATCAGG - Intergenic
1122759295 14:104009875-104009897 GCTACTGCAGAGGCTGAGGCAGG - Intronic
1122874146 14:104655573-104655595 GCCGAGGCAGAGGCAGCAGCCGG + Intergenic
1122919513 14:104874268-104874290 CCTCCGGCAGAGACTGCCACTGG + Intronic
1123025328 14:105421217-105421239 GCTGTGGGAGGGGCTGCCGCTGG - Intronic
1123072358 14:105647983-105648005 GATGCGGCAGAGCCGGCCGTGGG - Intergenic
1123092367 14:105747502-105747524 GATGCGGCAGAGCCGGCCGTGGG - Intergenic
1124409407 15:29423684-29423706 GCTACGCCAGAGGCTGAGGCAGG + Intronic
1124605182 15:31164218-31164240 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1124922312 15:34038912-34038934 GCGGCGGCGGAGGCGGCGGCGGG - Exonic
1124971184 15:34490700-34490722 GCTGGAGCAGAGGCAGCAGCGGG - Intergenic
1125333778 15:38607395-38607417 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1125538586 15:40457007-40457029 ACTGGGGCCCAGGCTGCCGCAGG + Intronic
1125671726 15:41478287-41478309 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1125685117 15:41559293-41559315 GCGGCGGCAGCGGCAGCGGCGGG - Exonic
1125686995 15:41569355-41569377 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1125709634 15:41774507-41774529 GCAGCGGTAGAGGCAGCAGCAGG - Exonic
1125722715 15:41852877-41852899 GCTTCGGCAGAGGCTGGAGCAGG - Exonic
1126098563 15:45106196-45106218 CCTGCTGCAGAGGCTGCAGCTGG + Exonic
1126214062 15:46133556-46133578 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1126450781 15:48806333-48806355 GCTGCGGCAGAAGCAGCAGCAGG + Intronic
1126999589 15:54486323-54486345 GCTGCTCCAGAGGCTGAAGCAGG + Intronic
1127420401 15:58799465-58799487 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1127510884 15:59639860-59639882 GCTGCTGCGGAGGCTGAGGCAGG - Intronic
1127789922 15:62390577-62390599 GCAGCGGCTGAGGCGGCTGCGGG + Intronic
1128003458 15:64216111-64216133 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1128455037 15:67827392-67827414 GCGGCGGCAGCGGCAGCTGCTGG + Intronic
1128538442 15:68508072-68508094 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1128738276 15:70065981-70066003 GCTGGGGCAGAGGGTGGGGCGGG - Intronic
1128972243 15:72117957-72117979 GCACCGGCAGAGGCGGCCGCTGG - Exonic
1129082450 15:73052551-73052573 GCTGGAGCAGCGGCGGCCGCGGG + Exonic
1129134884 15:73539400-73539422 GCTACTCCAGAGGCTGACGCAGG - Intronic
1129276090 15:74446203-74446225 GCTGCAGCTGGGGCTGCCACTGG + Exonic
1129329855 15:74821413-74821435 GCTGGGGCTGAGGCTGGGGCTGG + Intronic
1129867106 15:78917509-78917531 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1130197256 15:81792071-81792093 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1130509075 15:84573482-84573504 GCTACTCCAGAGGCTGACGCAGG - Intergenic
1130773632 15:86952117-86952139 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1131074870 15:89489226-89489248 GCTGCTGCAGAGGCTGAGGTGGG - Intronic
1131367842 15:91854323-91854345 GCTGGGGCAGGGGGTGCCGGGGG + Intronic
1131694136 15:94856636-94856658 GCGGCGGCGGAGGCAGCGGCAGG + Intergenic
1132549366 16:548010-548032 CCTGCGGCAGAAGCTGCGGACGG + Exonic
1132666601 16:1083731-1083753 GGTGCAGCAGAGGCGGGCGCTGG + Intergenic
1132676143 16:1122031-1122053 GCTGAAGCAGAGGCTGCGGACGG - Intergenic
1132865869 16:2092483-2092505 GCTGCGGCAGGTGCGGCTGCAGG - Exonic
1132871452 16:2117416-2117438 ACTGGGGCAGAGCCTGCGGCTGG - Intronic
1132941570 16:2511125-2511147 GCTACTGCAGAGGCTGAGGCAGG - Intronic
1133307093 16:4817229-4817251 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1133308599 16:4827786-4827808 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1133801590 16:9090303-9090325 GCTGCGGGCGACGCTGCCTCTGG + Intergenic
1133846244 16:9456600-9456622 GCTGAGGCGGAGGCTGAGGCAGG + Intergenic
1134055334 16:11166457-11166479 GCTGCCGCTGGGGCTCCCGCTGG - Exonic
1134665239 16:16013924-16013946 GATGGGGCAGAGGCTGACCCCGG + Intronic
1135469877 16:22720971-22720993 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1135712630 16:24730155-24730177 GCTGCGGCAGAGGCTCGCGCCGG - Intronic
1135737037 16:24940028-24940050 GCTGCTCCAGAGGCTGAGGCTGG - Intronic
1136223642 16:28844651-28844673 GCTGCTGCAGAGGGTGGGGCTGG - Intronic
1136365560 16:29807554-29807576 GCTGCCGCAGTGGCCGCCGGTGG + Exonic
1137723162 16:50639600-50639622 GCTGCAGCAGAGGATGAGGCTGG + Exonic
1137840126 16:51633206-51633228 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1138004773 16:53322478-53322500 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1138179321 16:54931409-54931431 GCGGCGGCGGCGGCGGCCGCGGG - Exonic
1138687807 16:58740963-58740985 GCTGCTCCAGAGGCTGAGGCGGG - Intergenic
1138690007 16:58758359-58758381 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1139365612 16:66431215-66431237 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1139471047 16:67178421-67178443 GCTGCGGTACGGGCTGCGGCCGG - Exonic
1139778176 16:69330195-69330217 GCCGCGGCAGGTGCTGGCGCTGG - Exonic
1139847275 16:69929862-69929884 GCTGGGGCACAGGGTGCCTCAGG + Intronic
1139890553 16:70251117-70251139 GCTGCAGCAGAGCCTGGTGCGGG - Exonic
1140223312 16:73058920-73058942 GCGGCGGCGGCGGCTGCGGCCGG + Intronic
1140290235 16:73647122-73647144 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1140703153 16:77601384-77601406 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1140829682 16:78739697-78739719 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1141128310 16:81416949-81416971 GCTGCTGCTGCTGCTGCCGCCGG - Intergenic
1141554793 16:84829877-84829899 GATGAGGAAGGGGCTGCCGCAGG - Intronic
1141616016 16:85209784-85209806 GCTGAGGCTGAGGGGGCCGCTGG + Intergenic
1141620905 16:85236019-85236041 GCTGCGGCTGGGGCTGGGGCTGG + Intergenic
1141805687 16:86340071-86340093 GCTGCAGCAGAGGCTGGAGAGGG - Intergenic
1142019340 16:87771174-87771196 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1142077562 16:88128884-88128906 GCAGCGGCAGATGCTGGCGAGGG - Intergenic
1142108400 16:88318408-88318430 GCTGGGGCAGAGGACACCGCTGG - Intergenic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1142374120 16:89697993-89698015 GCTGCAGCAGCGGCTGGCCCAGG - Exonic
1142711167 17:1724828-1724850 GCTGGGGCGGAGGCGGCCGCAGG - Intronic
1142807436 17:2378915-2378937 GCTGAGGCTGAGGCTGGGGCTGG - Intronic
1142807439 17:2378921-2378943 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1143202676 17:5123123-5123145 GCGGCGGCAGCGGCCGGCGCTGG + Intronic
1143641242 17:8198968-8198990 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1143795100 17:9329955-9329977 CCTGAGGCAGAGGGTGCAGCTGG + Intronic
1143927533 17:10385081-10385103 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1144339674 17:14301369-14301391 GCAGCAGCAGCGGCGGCCGCGGG + Exonic
1144500362 17:15781350-15781372 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1144760458 17:17704168-17704190 CCTGAGGCAGAGGCTGTCCCTGG + Intronic
1144930918 17:18858216-18858238 TCTGCAGCTGAGGCTGCGGCGGG + Exonic
1145296101 17:21593598-21593620 CATGCTGCAGGGGCTGCCGCTGG + Intergenic
1145379006 17:22376854-22376876 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379484 17:22379224-22379246 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145379963 17:22381594-22381616 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145380444 17:22383969-22383991 GCTGCAGCCGCGGCTGCCGCTGG - Intergenic
1145380921 17:22386316-22386338 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145381401 17:22388691-22388713 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382134 17:22392465-22392487 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382609 17:22394830-22394852 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145382889 17:22396193-22396215 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383462 17:22399016-22399038 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145383976 17:22401484-22401506 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384414 17:22403686-22403708 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145384733 17:22405148-22405170 GCTGCAGCCGCGGCTGCGGCTGG - Intergenic
1145993924 17:29094986-29095008 GCAGCGGGAGAAGCTGCAGCGGG - Exonic
1146215640 17:30977678-30977700 GCTACTCCAGAGGCTGCGGCAGG - Intronic
1147400412 17:40177541-40177563 GCGGCGGCAGAGGCAGCGGGCGG - Intronic
1147436937 17:40422244-40422266 GCTGCTGCAGAGGCTGAAGCAGG - Intergenic
1147661871 17:42121153-42121175 GCTGGGGCAGGGGCTGGTGCCGG + Exonic
1147686962 17:42291926-42291948 GCTGGAGCAGAGGATGGCGCTGG + Intronic
1147784290 17:42967683-42967705 GCTGCTTCAGAGGCTGAGGCAGG - Intronic
1147834739 17:43322004-43322026 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1148165087 17:45477937-45477959 GCTGGGGCAGAGGCTTCTGGTGG + Exonic
1148382392 17:47209489-47209511 GCTGGGGCAGGGGCTGGTGCAGG - Exonic
1148388529 17:47253790-47253812 GCTGCGGGAAAAGCGGCCGCGGG + Intergenic
1148443089 17:47721773-47721795 GCTACTGCTGAGGCTGCGGCAGG + Intergenic
1148868462 17:50641544-50641566 GAAGCTGCAGAGGCTGCGGCTGG + Intronic
1149334096 17:55617711-55617733 GCTGCAGAAGGGGCTCCCGCTGG - Intergenic
1149430843 17:56594544-56594566 GCTGCGGCAGCGGCCGTCGGGGG + Exonic
1149493429 17:57101308-57101330 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1150396319 17:64824662-64824684 GCTGGGGCAGAGGCTTCTGGTGG + Intergenic
1151313559 17:73308924-73308946 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1151328939 17:73395380-73395402 TCTCCGGGAGAGGCTGCAGCGGG + Exonic
1151396219 17:73824839-73824861 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1151535205 17:74735422-74735444 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1152012055 17:77724788-77724810 TGTGGGGCAGAGGCTGCCCCTGG + Intergenic
1152022152 17:77785742-77785764 TCTGCAACAGAAGCTGCCGCTGG + Intergenic
1152280058 17:79379922-79379944 GGTGCGGGAGAGGCCGCGGCAGG - Intronic
1152350861 17:79783519-79783541 GCTACTGCAGAGGCTGAGGCAGG - Intronic
1152519095 17:80845109-80845131 GCTGCAGGGGAGGCTGCCGTTGG - Intronic
1152545390 17:80997798-80997820 GCTGGGGCAGAGGCCGGCTCTGG - Intronic
1152782346 17:82231894-82231916 GCTGCGCAAGGGGCTGCCCCAGG - Intronic
1152985503 18:317112-317134 GCTACTGCAGAGGCTGAGGCGGG + Intergenic
1153566364 18:6422183-6422205 GCTGATGCAGAAGCTGCAGCAGG - Intergenic
1153582022 18:6582842-6582864 TCTGAGGCAGAGGCTGCAGCAGG - Intronic
1154341701 18:13508301-13508323 GCTGGGGTAGAAGCTGCAGCAGG + Intronic
1155202232 18:23527285-23527307 GCTACTCCAGAGGCTGCCGAGGG + Intronic
1156036159 18:32770321-32770343 GCTGCTGCGGCGGCTGCTGCTGG + Exonic
1156171736 18:34493968-34493990 GCGGCGGTAGCGGCTGCTGCAGG + Intronic
1156203614 18:34861372-34861394 GCTGCTGCAGAGGCTGAGACAGG + Intronic
1156921535 18:42528453-42528475 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1157180844 18:45496669-45496691 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1157225062 18:45855249-45855271 GCTGGGGCAGGGGCTGGAGCTGG - Intronic
1157504541 18:48217391-48217413 GCTGCAGGAGAGGCCTCCGCGGG - Intronic
1157599737 18:48886555-48886577 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1158354798 18:56606263-56606285 GCTGCTACAGAGGCTGAGGCAGG + Intronic
1158570929 18:58596482-58596504 GCTGCTGCAGCAGCCGCCGCAGG + Intronic
1158976505 18:62715753-62715775 GCTGCCGCAGCGGCGGCCGCCGG - Exonic
1159586901 18:70289733-70289755 TCTGCGGCTGAAGGTGCCGCCGG + Intronic
1159874951 18:73800622-73800644 GCAGCAGCAGAGGCAGCAGCTGG + Intergenic
1159957539 18:74530324-74530346 GCTGGGGCAGATGCTGGGGCAGG - Intergenic
1160100561 18:75916441-75916463 GCTCCGGCAAAGGAGGCCGCGGG + Intergenic
1160535269 18:79588342-79588364 GCTGCCGCGGGTGCTGCCGCCGG - Intergenic
1160725067 19:614197-614219 GCTGGGGCAGGGGCAGCGGCTGG + Intronic
1160987267 19:1844819-1844841 GCTGCGCCACAGGCTGACTCAGG - Intronic
1161008144 19:1946722-1946744 GCTGCTGGAGAGGCTGAGGCAGG - Intronic
1161027117 19:2041870-2041892 GCTGTGGCAGCGACTGCGGCTGG - Exonic
1161397980 19:4054691-4054713 GCAGCGGCGGCGGCGGCCGCGGG + Exonic
1161679975 19:5675152-5675174 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1161710058 19:5842707-5842729 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1161736568 19:5995388-5995410 GCTGGGGCTCAGACTGCCGCTGG - Intronic
1161878916 19:6933497-6933519 GCTACCGCAGAGGCTGAGGCAGG - Intronic
1161911589 19:7198302-7198324 GCTCGGGCAGTGGCCGCCGCCGG + Intronic
1162021166 19:7869250-7869272 GCGGCTGCCGAGGGTGCCGCGGG - Exonic
1162100216 19:8334652-8334674 GCTGCGGAGGAGGCAGCGGCGGG - Exonic
1162372930 19:10289866-10289888 GCGGCGGCAGAGGCGGCGGGGGG - Intergenic
1162562753 19:11426947-11426969 GTTGCGGCAGAGGCGGCTGGAGG - Exonic
1162730794 19:12717381-12717403 GCTGCTTCAGAGGCTGAGGCAGG - Intronic
1162778628 19:12995504-12995526 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
1162809537 19:13155682-13155704 GCGGCGGCAGAGCCAGCCGTCGG - Intergenic
1163008470 19:14410605-14410627 CCTGAGGCAGAGACAGCCGCTGG + Intronic
1163535668 19:17874816-17874838 GCTGGGACAGAGGCTTCCTCAGG - Intronic
1164230054 19:23279400-23279422 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1164590626 19:29505022-29505044 GCTGAGGCTGAGGCTGAGGCCGG - Intergenic
1164834532 19:31349229-31349251 GCGGCGGCAGTGGCAGTCGCCGG - Exonic
1165010870 19:32845381-32845403 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1165293304 19:34906185-34906207 GCAGCGGCAGTGGCAGCAGCGGG - Intergenic
1165348421 19:35263465-35263487 GCTGCTCCAGAGGCTGAGGCGGG - Intronic
1165615996 19:37200977-37200999 GCTACTCCAGAGGCTGACGCAGG + Intronic
1165850915 19:38849900-38849922 GCTGGAGCAGAGGCAGCAGCCGG - Exonic
1166069187 19:40377472-40377494 GCTAGGGCAGAGGCTTCCTCTGG - Intronic
1166331637 19:42081175-42081197 GCAGAGGCGGAGGCTGCCGTTGG + Exonic
1166358672 19:42242515-42242537 GCGGCGGCAGCGGCGGCGGCTGG - Exonic
1166643311 19:44512802-44512824 GCTGGGGAAGAGGCTGGTGCTGG - Intronic
1167001112 19:46746266-46746288 GCGGCGGCGGAGGCAGCCCCGGG - Exonic
1167137635 19:47626831-47626853 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1167158957 19:47755452-47755474 GCGGCGGCAGAGGCGGCGGCAGG + Exonic
1167470832 19:49675540-49675562 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1167578940 19:50330902-50330924 GCTGCGGCTGGGGCTGCGGAGGG + Intronic
1167744684 19:51343614-51343636 GCTGCTGCAGAGGCTGAGACGGG - Intergenic
1168076351 19:53982605-53982627 GCGGCGGCGGAGGCGGCGGCGGG + Exonic
1168246990 19:55117447-55117469 GCTGCGGCAGTGGGGGGCGCGGG - Exonic
1168288730 19:55347020-55347042 GCTGGGGCTGAGGCAGCCACTGG - Exonic
1168339126 19:55613810-55613832 GCTGCGGCGGGGGCTGCGGCGGG - Exonic
1168663896 19:58187835-58187857 GCTACTGCAGAGGCTGAGGCTGG - Intronic
925802191 2:7612272-7612294 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
925969579 2:9096957-9096979 GCAGTGGCAGGGGCTGCTGCAGG + Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
926253580 2:11170346-11170368 GCTGCTGAAGAGGCTGATGCTGG + Intronic
926336036 2:11863669-11863691 GCTGAGCCAGAGGCTTCCACAGG - Intergenic
926401742 2:12504108-12504130 GCTACGCCAGAGGCTGAGGCAGG - Intergenic
927792543 2:26021522-26021544 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
927973400 2:27320123-27320145 GCTGCTGAAGAGGCTGAGGCAGG + Intronic
928549502 2:32357252-32357274 GCTGCGGCTGCGGCGGCCTCGGG + Exonic
928572850 2:32626536-32626558 GCTGCTCAGGAGGCTGCCGCAGG - Intergenic
929156340 2:38791819-38791841 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
929659559 2:43770218-43770240 GCTACTGCAGAGGCTGAGGCGGG - Intergenic
930136097 2:47905576-47905598 GCGGCGGCGGAGGCTGCTGCTGG + Exonic
930136109 2:47905618-47905640 GCTGCGGCGGCGGCTGCTGCGGG + Exonic
930449080 2:51511339-51511361 CCTGCAGCAGAGCCTGCAGCAGG + Intergenic
930811963 2:55551637-55551659 GCTGCTTCAGAGGCTGAGGCAGG + Intronic
932773959 2:74516060-74516082 GCTGCGGCCGCCGCTGCCCCCGG + Exonic
932793225 2:74673673-74673695 GCTGCGACAAAGGCTGGGGCTGG - Exonic
934555785 2:95286490-95286512 GCTGGGGCAGCGGCTGCAGGAGG + Exonic
935441290 2:103099216-103099238 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
936679496 2:114753795-114753817 GCTGCTTCAGAGGCTGAGGCAGG + Intronic
937221600 2:120345656-120345678 GCTGCGGCGGGCGCTGCGGCGGG - Intergenic
937276071 2:120685123-120685145 GCTGGGGGAGAGGCTGCAGTGGG + Intergenic
937276108 2:120685243-120685265 GCTGGGGGAGAGGCTGCAGGAGG + Intergenic
937494138 2:122400203-122400225 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
937956063 2:127422426-127422448 GCTGCTGCGGCGGCTGCTGCTGG - Intronic
937986705 2:127641296-127641318 CCTGGGGCTGAGGCTGCCGAGGG - Intronic
938058284 2:128233199-128233221 GAGGCTGCAGAGGCTGACGCGGG - Intergenic
938486011 2:131709274-131709296 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
940620662 2:156109213-156109235 GCTGCGCCGGAGGCTGAGGCAGG - Intergenic
940749790 2:157612514-157612536 GCTGCAGCAGTTGCTGCCACTGG - Intronic
940877349 2:158911220-158911242 GCTGCGTAAGAGGCTGAGGCAGG - Intergenic
941094325 2:161218580-161218602 GCTACTTCAGAGGCTGCAGCAGG + Intronic
941476761 2:165958959-165958981 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
941566763 2:167118368-167118390 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
941951529 2:171160982-171161004 GCGGCGGCAGCGGCGGCCGCGGG + Intronic
942447519 2:176088018-176088040 GCTCCGGCAGCGGCAGACGCGGG - Intergenic
942454826 2:176130415-176130437 GCTGCGGCGGCGGCGGCGGCGGG + Exonic
942550475 2:177110730-177110752 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
944457507 2:199911042-199911064 GCAGCAGCAGGGGCGGCCGCAGG - Intergenic
945687641 2:212991666-212991688 GCTACAGCAGAGGCTGAGGCAGG - Intergenic
945699417 2:213151723-213151745 GCTGCGGCGGCGGCGGCGGCGGG + Intronic
946329347 2:219000872-219000894 GCTCAGGCAGAGGCAGCCCCGGG - Intergenic
946404107 2:219483670-219483692 CCTGCGCCAGCGGCTGCTGCGGG + Exonic
946410844 2:219514511-219514533 GCAGCGGCAGAGGCAGCACCAGG + Exonic
947276811 2:228401395-228401417 CCTTGGGCAGAGGCTGCAGCTGG + Intergenic
947741723 2:232487820-232487842 GCGGCGGCAGAGGAGGCGGCGGG - Exonic
947749440 2:232524946-232524968 GCTGGGGCAGAGGCGACCCCAGG - Intronic
947763272 2:232619420-232619442 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
947963578 2:234260103-234260125 GCTGAGGCTGAGGCTGGGGCTGG - Intergenic
948231872 2:236354922-236354944 GCTGTGTCAGAGGCTGCCGTGGG - Intronic
948502731 2:238406978-238407000 GCTGCTGCAGATGCTTCCCCAGG + Intergenic
948590222 2:239044519-239044541 GCGGTGGCAGAGGCTGCCGAGGG + Intergenic
948757433 2:240167649-240167671 GCTGCTGCAGAGGCCGCCCCAGG - Intergenic
948765188 2:240215830-240215852 GCTGGGGCAGGGGCAGCCCCGGG + Intergenic
948971510 2:241431361-241431383 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1168998643 20:2150785-2150807 ACTACGGCAGAGGCTGGAGCTGG - Intronic
1170240900 20:14165015-14165037 GCCCTGGCAGAGGCTGCTGCAGG + Intronic
1170365887 20:15597965-15597987 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1171544029 20:25987198-25987220 GCTGCCGCGGAGGCTGCAGCAGG + Intergenic
1172406681 20:34694934-34694956 GCTGCTGCAGAGGCTGAGACAGG + Intergenic
1172444134 20:34984445-34984467 GCTGGGGCAGAGGAGGCTGCAGG + Intronic
1172529209 20:35618636-35618658 GCTGCTGCAGCTGCTGCCCCTGG - Exonic
1172609069 20:36236028-36236050 GCAGCAGCGGAGGCTGACGCTGG + Intergenic
1173019778 20:39257512-39257534 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1173548164 20:43914856-43914878 GCGGCGGCGGCGGCTCCCGCGGG - Exonic
1173981055 20:47224518-47224540 GATGCGGCAGAGCCTGGAGCAGG - Exonic
1174446107 20:50592451-50592473 TCTGGGGCAGAGGCTGGAGCTGG + Exonic
1174742268 20:53026461-53026483 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1175429523 20:58891673-58891695 GCTGCGGCGGCGGCGGGCGCGGG - Intronic
1175488227 20:59360773-59360795 TCTGTGGCACAGGCTGCAGCAGG + Intergenic
1175564051 20:59958774-59958796 GCTGCTGCTGTGGCTGCTGCAGG + Exonic
1175882674 20:62269944-62269966 CCTGCGGCTCAGGCTGCTGCAGG - Intronic
1175900972 20:62359816-62359838 GGTGGGGCAGGGGCTGGCGCAGG - Intronic
1175969789 20:62679090-62679112 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1176029884 20:63006806-63006828 GCAGCGGCAGCGGCAGCGGCGGG - Exonic
1176062323 20:63177857-63177879 GCGGCAGCAGCGGCTCCCGCCGG + Intergenic
1176071601 20:63229532-63229554 GCAGCGGCAGCCGCTGCCGGGGG - Intergenic
1176078754 20:63261212-63261234 GCTGCAGATGAGGCTGCCCCAGG + Intronic
1176088459 20:63308561-63308583 GCTGGGGCAGAACCTGCAGCCGG + Exonic
1176208326 20:63903417-63903439 GCTGCTACAGAGGCTGAGGCAGG - Intronic
1176267782 20:64219792-64219814 GCTGCTGCAGCTGCTGCTGCTGG - Exonic
1176379191 21:6103342-6103364 GCAGGGGCAGAGGCAGCAGCAGG + Intergenic
1176379205 21:6103384-6103406 GCAGGGGCAGAGGCAGCGGCAGG + Intergenic
1177808255 21:25897222-25897244 GCTGCTGGGGAGGCTGACGCAGG - Intronic
1178087133 21:29123172-29123194 GCTGCTTCAGAGGCTGAGGCAGG - Intronic
1178294011 21:31393439-31393461 GCAGAGGCAGAGGATGCTGCTGG - Intronic
1178334504 21:31731699-31731721 GCTGCGGCGGCGGCTGCTCCGGG + Exonic
1178865095 21:36320403-36320425 GCGGCGGCGGGGGCTGCGGCGGG + Intronic
1179085032 21:38208269-38208291 GCTGAGGCAGAGGCTGGTGCAGG - Intronic
1179258288 21:39736805-39736827 GCTGAGGCTGAGGCTGAGGCCGG + Intergenic
1179481635 21:41682163-41682185 GCTGTCCCAGAGGCTGGCGCTGG - Intergenic
1179518360 21:41925557-41925579 GCAGAGGCAGGGGCTGGCGCTGG - Intronic
1179599997 21:42471162-42471184 GCTACGTGAGAGGCTGCAGCCGG - Intergenic
1179744268 21:43434853-43434875 GCAGGGGCAGAGGCAGCGGCAGG - Intergenic
1179744282 21:43434895-43434917 GCAGGGGCAGAGGCAGCAGCAGG - Intergenic
1179902281 21:44400414-44400436 GCTGCGGGAGAGGCTCCTGGGGG + Intronic
1180066366 21:45414569-45414591 CCTGGGGCAGAGTCGGCCGCAGG - Intronic
1180224774 21:46385894-46385916 GCTGCAGCAGAGGCGGGAGCGGG + Exonic
1180635231 22:17258482-17258504 GGTGGGGCAGGGGCTGCGGCAGG - Intergenic
1180649970 22:17369549-17369571 GCTGCGGCTGCGGCTGCCCGCGG - Exonic
1180766873 22:18350381-18350403 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1180779440 22:18511997-18512019 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1180796779 22:18609715-18609737 GCGACGGCAGATGCTGGCGCTGG - Exonic
1180812156 22:18769318-18769340 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1180889036 22:19271995-19272017 GCTACTTCAGAGGCTGACGCAGG + Intronic
1181085211 22:20436652-20436674 GCAGCCGCAGAGGCGGCCGCCGG - Intronic
1181169183 22:20998677-20998699 GCTGGGGCAGAGGCTGAGCCGGG + Exonic
1181198315 22:21203565-21203587 GCTGGGGCTGGGGCTGGCGCTGG - Intergenic
1181224945 22:21385556-21385578 GCGACGGCAGATGCTGGCGCTGG + Exonic
1181253687 22:21549257-21549279 GCGACGGCAGATGCTGGCGCTGG - Exonic
1181401426 22:22652228-22652250 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
1181410035 22:22712292-22712314 GCAGAGTCAGAGGCTGCTGCTGG - Intergenic
1181586874 22:23857474-23857496 GCTGCGGCAGAGGCGGATGGAGG + Exonic
1182061077 22:27397941-27397963 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1182225856 22:28798418-28798440 GCTGCTCCGGAGGCTGACGCAGG - Intronic
1182442792 22:30373925-30373947 GCTGCTGCAGAGCCTGCAGAGGG + Exonic
1183069648 22:35387192-35387214 GGGGAGGCAGAGGCTGCCCCAGG - Intronic
1183095616 22:35550327-35550349 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1183161988 22:36120555-36120577 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1183411734 22:37658908-37658930 GCTGCTGGAGCGGCTGGCGCGGG + Exonic
1183482641 22:38073672-38073694 GCAGCAGGAGAGGCTGGCGCAGG - Intronic
1183566079 22:38616297-38616319 GCAGCTGCAGTGGCTGCCGGGGG + Intronic
1183651812 22:39159871-39159893 GCTGCTGGAGAGGCTGAGGCAGG + Intergenic
1183662647 22:39230553-39230575 GCTGCGGCAGAGGCGGGAGATGG + Intronic
1183702289 22:39457416-39457438 CCGGCGGCAGCGGCTGCGGCGGG - Exonic
1183717012 22:39539281-39539303 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1183740023 22:39664213-39664235 GCTGAGGCAGGGGCTGACCCAGG - Intronic
1183831125 22:40418796-40418818 GCTCCGGCAGAAGCAGCAGCTGG - Exonic
1183952807 22:41361232-41361254 GCTACTGAAGAGGCTGACGCAGG - Intergenic
1184315251 22:43682909-43682931 AGTGCGGCAGAGGCAGGCGCTGG + Intronic
1184476065 22:44722066-44722088 GCTGGGGCGGGGGCTGCCTCGGG + Intronic
1185143600 22:49117301-49117323 GCTGAGGCAGGGGCTGGGGCTGG + Intergenic
1185249274 22:49791251-49791273 GCTACGGCAGAGCCTGCGGGAGG + Intronic
1185288532 22:50013013-50013035 CCGGCGGGATAGGCTGCCGCCGG + Intergenic
1185301633 22:50084011-50084033 GGTGCTGCAGGGGCTGCCGGCGG + Intronic
1185371197 22:50461688-50461710 GCTGCGGCCGCGCCTGCTGCCGG - Exonic
1185388737 22:50548008-50548030 GCTGGGGCAGGGGATGCGGCTGG - Intergenic
1185388758 22:50548056-50548078 GCTGGGGCAGGGGATGCGGCTGG - Exonic
1203228492 22_KI270731v1_random:91272-91294 GCTGGGGCTGGGGCTGGCGCTGG + Intergenic
950153815 3:10707951-10707973 GCTGCCGCCGCCGCTGCCGCTGG + Intronic
950518662 3:13483355-13483377 CCTGGGGCAGGGGCTGCCACAGG + Intronic
950604247 3:14064370-14064392 GCTGCTGCTGGGGCTGCTGCTGG - Exonic
950604253 3:14064397-14064419 GCTGCTGCTGTGGCTGCTGCTGG - Exonic
951217779 3:20040640-20040662 GCGACGGCAGTGGCTGCAGCGGG + Exonic
951543604 3:23806029-23806051 GCTGCTGCTGCGGCTGCGGCTGG - Exonic
952353181 3:32560319-32560341 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
952891435 3:38044449-38044471 GCTGCTTCAGAGGCTGAGGCAGG + Intronic
952942953 3:38457090-38457112 GCTGCGCCAGAGGCTGAGGCAGG + Intronic
953157386 3:40387206-40387228 GCTGCCGCAGAGGCGGCCCGCGG - Exonic
953880122 3:46687111-46687133 GCTGCCGCAGCGCCTTCCGCTGG + Exonic
954248615 3:49351271-49351293 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
954632490 3:52055119-52055141 CCTGCGCCCGAGGGTGCCGCAGG + Intronic
954707606 3:52489397-52489419 GCTGCTGCAGGGGCTGGAGCTGG - Exonic
954707610 3:52489409-52489431 CCTGAGGCTGAGGCTGCTGCAGG - Exonic
955849415 3:63203885-63203907 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
955911611 3:63864056-63864078 GCTGCAGCCGGGGCCGCCGCCGG - Intergenic
956011986 3:64841931-64841953 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
956198929 3:66684807-66684829 GCAGTGACAGAGGCTGCAGCTGG - Intergenic
956228532 3:66986900-66986922 GCTGAGGCTGAGGCTGAGGCAGG + Intergenic
956678024 3:71753672-71753694 GCGGCGGCAGCGGCGGCGGCGGG + Intronic
957017567 3:75086027-75086049 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
957915425 3:86682492-86682514 CCTCAGGCAGAGGCTGCAGCAGG + Intergenic
959661039 3:108868567-108868589 GCTGCTCCGGAGGCTGCGGCAGG + Intergenic
960638306 3:119805454-119805476 GCTGAGGCGGAGGCTGAGGCGGG + Intronic
961081618 3:124033202-124033224 GCTGCGGCGGCGGCGGCGGCGGG + Intergenic
961596310 3:128020540-128020562 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
961736276 3:129003890-129003912 GCTGCGGCGGAGGCCCGCGCTGG + Exonic
962320992 3:134390056-134390078 GCTTTGGCAGAGGGTGCCGCTGG - Intergenic
962601269 3:136992403-136992425 GCTGCAGGAGAGGCAGCCACAGG + Intronic
963253043 3:143119852-143119874 GCGGCGGCGGCGGCTGCGGCGGG + Exonic
963916353 3:150862122-150862144 GCTGAGGCAGAGCCTGGAGCAGG - Intergenic
964112428 3:153101580-153101602 GCTGCGCCGGAGGCTGAGGCAGG + Intergenic
965911898 3:173788707-173788729 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
966003582 3:174980386-174980408 GCTGCTGCAGAGGCTGAGCCAGG + Intronic
966778485 3:183563306-183563328 GCTGCTCCAGAGGCTGAAGCAGG + Intergenic
966790059 3:183659423-183659445 GCTGCTGCAGAGACTGAGGCAGG + Intronic
966867980 3:184271505-184271527 GCTACGCCAGAGGCTGAGGCAGG - Intronic
966883267 3:184361615-184361637 GCTGCGCCAGCGGCGCCCGCCGG - Exonic
966941451 3:184750492-184750514 GTTGGGGGAGAGGCTGCTGCCGG + Intergenic
968498467 4:932055-932077 GCTGCGGCTGCGGGTGCGGCGGG - Exonic
968516227 4:1016769-1016791 GCTGGGGCAGAGCCTGGCCCTGG + Intronic
968516414 4:1017463-1017485 ACTGCGGCAGGGGCTGATGCTGG - Intronic
968635208 4:1674944-1674966 GCTCCGGCAGGGGCTTCCTCTGG - Intronic
969582321 4:8072489-8072511 GCTGCGGCTGTTGCTGCTGCTGG - Intronic
969791725 4:9497811-9497833 GATGCAGCAGAAGCTGCGGCGGG + Intergenic
970202890 4:13627515-13627537 GCTGCGGCTGCGGCTGCGGCGGG + Exonic
970333066 4:15003900-15003922 GCTGCGGCTGGGGCGGCTGCTGG - Exonic
971279989 4:25234571-25234593 GGTGCGGCTGCGGCTGGCGCCGG - Intronic
971280529 4:25239444-25239466 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
971281677 4:25246826-25246848 GCAGCTGCAGAGGGTGCTGCTGG - Intronic
972725826 4:41745970-41745992 GCAGCGGCAGCGGCGGCAGCTGG - Exonic
972786093 4:42327864-42327886 GCTGAGGCAGAGGCTGTATCCGG - Intergenic
973338927 4:48985166-48985188 GCTGCGCGAGAGGCTGAGGCAGG + Intergenic
973904908 4:55519161-55519183 GCTGCTCCAGAGGCTGAGGCGGG - Intronic
974011882 4:56614540-56614562 GCTGCCCCAGAGGCTGAGGCAGG + Intergenic
975048436 4:69830575-69830597 ACTGCTGCAGATGCTGCAGCTGG + Intronic
975405322 4:73981954-73981976 GCTGCGGCAGAGCTTCCAGCAGG + Exonic
975552853 4:75630841-75630863 GCTGGGGCAGGGGCGGGCGCCGG + Intergenic
976337403 4:83906217-83906239 GCTGCAGCAGCTGCTGCTGCTGG + Intergenic
976565991 4:86551714-86551736 GCTACTGGAGAGGCTGCGGCAGG - Intronic
976774826 4:88697258-88697280 GCTGCGGCAGAGGCTGCCGCGGG - Exonic
977177537 4:93834986-93835008 GAGGCGGCAGAGGCGGCGGCGGG + Intergenic
978689345 4:111487392-111487414 GCTACTTCAGAGGCTGCGGCAGG + Intergenic
980050324 4:128033140-128033162 GCTACTGCAGAGGCTGAGGCAGG + Intronic
980117820 4:128696542-128696564 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
980341696 4:131557866-131557888 GCTGCTCCAGAGGCTGAGGCCGG + Intergenic
980405075 4:132344923-132344945 GCTGGGGCCGGGGCTGCGGCTGG + Intergenic
980798003 4:137710898-137710920 GCTGTGGCAGACGCTGGCACGGG + Intergenic
980897679 4:138875418-138875440 GCTGTGCCAGAGGCTGAGGCAGG + Intergenic
981747512 4:148065897-148065919 GCTACTGCAGAGGCTGAGGCAGG + Intronic
981913259 4:150007173-150007195 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
982781389 4:159494709-159494731 GCTGAGGCTGAGGCTGAGGCTGG - Intergenic
983398528 4:167234085-167234107 GCCGCGGCGGTGGCTGCAGCCGG - Exonic
984104017 4:175521742-175521764 GCTGCTTCAGAGTCTGCCGTTGG - Intergenic
984556343 4:181218574-181218596 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
984778537 4:183504725-183504747 GCAGGCGCAGAGGCGGCCGCGGG + Intergenic
985126064 4:186695901-186695923 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
985682583 5:1264345-1264367 GCTGGGGCAGGTGCTGCTGCAGG - Intronic
985722378 5:1496511-1496533 GCTGCAGAGGAGGCTGCGGCGGG + Intronic
985730939 5:1548433-1548455 CCTGCGGGAGTGGCTGCTGCTGG + Intergenic
985886881 5:2686927-2686949 ACTGGTGCAGAGGCTGCCGCTGG + Intergenic
986013540 5:3738381-3738403 GATGCAGCAGAGCCTGCTGCTGG + Intergenic
986297087 5:6448738-6448760 GCGGCGGCGGCGGCTGCGGCGGG + Exonic
986336341 5:6758615-6758637 GCTGCTCCAGAGGCTGCTCCTGG - Intergenic
986692189 5:10322196-10322218 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
986858795 5:11903690-11903712 GCGGCGGCGGCGGCTGCTGCGGG - Intronic
986859023 5:11904513-11904535 GCGGCAGCAGCGGCAGCCGCGGG + Intergenic
986871218 5:12048993-12049015 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
987372612 5:17207258-17207280 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
987767165 5:22247561-22247583 GCTGCAGGAGAGGCTGAGGCAGG + Intronic
991687592 5:69196048-69196070 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
992694290 5:79269837-79269859 GCTACTGCAGAGGCTGAGGCAGG - Intronic
992910726 5:81393925-81393947 GCTGCGGGAGCGGCGGCGGCTGG - Intronic
993457318 5:88141488-88141510 GCAGCCGCAGAGGCTGACGCGGG + Intergenic
993849675 5:92991047-92991069 GCTGCAGCTCAGGCTGCTGCAGG + Intergenic
993901119 5:93584837-93584859 GCGGCGGCGGAGGCAGCGGCCGG + Exonic
994043468 5:95284148-95284170 GCTGCTCCCGAGGCCGCCGCGGG + Exonic
994440979 5:99802211-99802233 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
994487954 5:100402678-100402700 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
995650532 5:114362920-114362942 GCGGCGGCAGCGGCTGCAGACGG - Exonic
996242265 5:121218647-121218669 TCTGAGGCAGAGGGTGCCACTGG + Intergenic
996316725 5:122168599-122168621 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
996405297 5:123098180-123098202 GCTGCGGCCAAGGCTGGCGGCGG + Intronic
996790755 5:127290707-127290729 GCTGCTGCAGCTGCTGCTGCCGG - Intergenic
996862821 5:128084255-128084277 GCGGCGGCAGCGGCGGCGGCTGG + Exonic
997165399 5:131655804-131655826 GCTACTCCAGAGGCTGACGCAGG + Intronic
997319079 5:132963297-132963319 GCTGCGGCAGTGGCGGCGCCGGG + Exonic
998116113 5:139538759-139538781 GCTACTCCAGAGGCTGACGCAGG + Intronic
998779499 5:145640530-145640552 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
999232374 5:150069363-150069385 GCTGTGCAAGAGGCTGCCCCGGG - Intronic
1000209892 5:159099251-159099273 GCAGCGGCAGCTGCTGCCGCGGG - Intronic
1000358266 5:160421959-160421981 GCTGCGGCTGGGGCTGAAGCTGG + Exonic
1001051925 5:168420645-168420667 GCTGAGGCAGAGGATCCCGGGGG - Intronic
1001211358 5:169812959-169812981 GAAGCGGCAGATGCTGCTGCTGG + Intronic
1002043501 5:176530137-176530159 GCGGGGGCAGTGGCTGCTGCAGG + Exonic
1002093560 5:176818094-176818116 GCAGGGGCAGGGGCTGCAGCTGG - Intronic
1002160457 5:177311533-177311555 GCTGTGCCTGGGGCTGCCGCTGG - Intronic
1002811238 6:631424-631446 GCTACTGCAGAGGCTGAGGCAGG + Intronic
1002895566 6:1378319-1378341 GCCCCGGCAGCGGCGGCCGCCGG - Intergenic
1002927346 6:1611910-1611932 GCGGCGGCGGCGGCGGCCGCAGG + Exonic
1003493043 6:6640470-6640492 GCAGCTACAGAGGCTGCGGCAGG + Intronic
1003525519 6:6893534-6893556 GCAGACGCAGAGGCTGACGCTGG - Intergenic
1003546824 6:7066177-7066199 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1004392263 6:15219606-15219628 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1004793186 6:19051372-19051394 TCTCAGGCAGAGGCTGCAGCAGG - Intergenic
1004958599 6:20758901-20758923 GCTGAGGCTGAGGCTGAGGCTGG + Intronic
1005689933 6:28294339-28294361 GCTGATGCAGATGCTGCAGCAGG + Intronic
1005940469 6:30556265-30556287 CCTGCGGCGGGGGCTGCCCCGGG - Exonic
1005940706 6:30557318-30557340 TCTGCGGCAATGGCTGCAGCGGG - Exonic
1006073814 6:31516399-31516421 GCTGGGGCAGAAGCTGCAGCAGG - Intergenic
1006346947 6:33490331-33490353 GCTGCTTCAGAGGCTGAGGCAGG - Intergenic
1006392289 6:33765594-33765616 GCTGCGGCTCTGGCTGCTGCTGG + Intergenic
1006421286 6:33935686-33935708 GCTGCAGCAGAGGCAGCTGCGGG + Intergenic
1006631204 6:35431231-35431253 GCTGCTCCAGAGGCTGACACAGG + Intergenic
1006860781 6:37170433-37170455 GTTGCGGCTGTGGCTGCGGCTGG - Exonic
1007174090 6:39884602-39884624 GCTGAGGCTGAGGCTGAGGCTGG + Intronic
1007174093 6:39884608-39884630 GCTGAGGCTGAGGCTGGGGCTGG + Intronic
1007330247 6:41101218-41101240 CCTGCGGGAGAGGCGGCCGTTGG + Intergenic
1007409386 6:41653217-41653239 CCTGCGGCAGCGGCAGCAGCAGG - Intronic
1007559814 6:42797862-42797884 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1007588314 6:43006465-43006487 GCTGGGGCTGGGGCTGCGGCTGG - Exonic
1007665294 6:43509939-43509961 GCTGCGGCGGAGGCTGCGGCGGG + Exonic
1009952627 6:70413948-70413970 GCAGGGGCAGGGGCGGCCGCGGG - Intronic
1010968161 6:82235983-82236005 GCTACGGGGGAGGCTGCGGCAGG - Intronic
1011652358 6:89518288-89518310 GCTGCTGCGGAGGCTGAGGCAGG + Intronic
1012570024 6:100712867-100712889 GCTGCTGCAGAGCCTGAGGCAGG - Intronic
1012998830 6:106000334-106000356 GCTGAGGCAGAGGCTGAGGTAGG + Intergenic
1013220646 6:108074591-108074613 GTTGCCGCCGTGGCTGCCGCTGG - Exonic
1013943137 6:115690098-115690120 GCTGCGGCAGAGCTAGCCTCAGG - Intergenic
1014224102 6:118828495-118828517 GCTGCTGCAGAGGCTGAGGCAGG - Intronic
1014632395 6:123803416-123803438 GCTGCCGCCCAGGCGGCCGCAGG - Intergenic
1014944067 6:127476072-127476094 GCTGCGGCAGCACCTGCAGCTGG - Exonic
1015732489 6:136362645-136362667 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1015732495 6:136362663-136362685 GCTGGGGCCGAGGCTGGAGCTGG + Exonic
1015979583 6:138825469-138825491 GCTGCTGGAGAGGCTGAGGCAGG + Intronic
1016060133 6:139621471-139621493 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1016329868 6:142945113-142945135 GCTGCGGCTGCGGCGGCCGGCGG - Exonic
1016861301 6:148721244-148721266 GCTGCAGCAGGGGCAGCCACAGG - Intergenic
1016923181 6:149316981-149317003 CCCGCGGCGGAGGCTGGCGCCGG - Intronic
1016934399 6:149438664-149438686 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1018259875 6:161959424-161959446 GCTGCTGCAGAGGCTGTGGCAGG - Intronic
1018745617 6:166759796-166759818 GCTGCGGCTGTGTCTTCCGCAGG - Intronic
1019169359 6:170123342-170123364 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1019320260 7:411928-411950 GCGGCTGGAGAGGCTGCCCCGGG - Intergenic
1019361500 7:607113-607135 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1019378857 7:711265-711287 CCTGGGGCAGAGGCGGCAGCCGG - Intronic
1019405281 7:880227-880249 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1019681910 7:2355135-2355157 GCCGAGGCAGAGGCGGCCTCCGG + Exonic
1019709506 7:2511811-2511833 GCTGCGGCAGGGGCAGGGGCTGG - Intergenic
1020224869 7:6272339-6272361 GCAGCGGCAGCGGCGTCCGCTGG - Intronic
1021572419 7:22079897-22079919 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1022088159 7:27088475-27088497 GCTCGGGCAGCGGCGGCCGCGGG - Intergenic
1022107181 7:27204989-27205011 GCCGCTGCCGCGGCTGCCGCCGG - Intergenic
1022396205 7:29989757-29989779 GCAGTGGCGGAGGCGGCCGCCGG + Intronic
1022593321 7:31687207-31687229 TCTGCGGCAGTGGCTGCTGCTGG - Exonic
1022758681 7:33323947-33323969 GCTGCTCGAGAGGCTGACGCAGG - Intronic
1022943577 7:35261266-35261288 GGTGCAACAGAGACTGCCGCGGG + Intergenic
1023078586 7:36506826-36506848 GCTGAGGCTGAGGCTGAGGCAGG - Intergenic
1023399030 7:39778397-39778419 GCTGAGGCAGAGGTTGCAGTGGG - Intergenic
1023418298 7:39951393-39951415 GCAGCAGCAGCGGCGGCCGCCGG + Exonic
1023888645 7:44377533-44377555 ACTGGAGCAGAGGCTGCTGCTGG - Intergenic
1024082421 7:45866155-45866177 GCTGCCGCTGCCGCTGCCGCTGG + Intergenic
1024620467 7:51152804-51152826 GTTGGGGCAGAGGCTGGCGATGG + Intronic
1024651414 7:51406300-51406322 GCTGAGGCAGAGGTTGCAGTGGG + Intergenic
1024692110 7:51814328-51814350 GCTGCGGCAGAGGGTACCTGTGG + Intergenic
1025089965 7:56053640-56053662 GCTGCTTCAGAGGCTGAGGCAGG + Intronic
1025133618 7:56392109-56392131 GCTGAGGCAGAGGTTGCAGTGGG + Intergenic
1025203957 7:56980733-56980755 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1025623479 7:63196456-63196478 GCTGCTCCGGAGGCTGACGCAGG + Intergenic
1025667983 7:63596198-63596220 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1026615496 7:71899253-71899275 GCTGCTGGGGAGGCTGCGGCAGG - Intronic
1026627926 7:72012667-72012689 TCTGCTGCAGAGGCTGCAGGAGG - Intronic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1026850429 7:73719894-73719916 GCTGGGGCAGAGGAGGCAGCAGG - Intergenic
1026906037 7:74063318-74063340 GCTGCGGCAGCGGCGGCGGCGGG - Exonic
1026923696 7:74174430-74174452 GCGGCGGCAGAGGGTGAGGCGGG + Exonic
1027180142 7:75933498-75933520 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1027245213 7:76362273-76362295 GCTACTCCAGAGGCTGACGCAGG + Intergenic
1027374510 7:77537115-77537137 GCTGCGGCTGCGGCTGCTGGCGG + Intergenic
1027656518 7:80936895-80936917 GCTGCTCGAGAGGCTGCGGCAGG - Intergenic
1027734372 7:81914405-81914427 GCTGCTGCTGAGTCTGCAGCGGG + Intergenic
1027737769 7:81956097-81956119 GCTACGCCAGAGGCTGAGGCAGG - Intronic
1029286306 7:99468466-99468488 GCTGGGGCAGAGGGCCCCGCAGG + Intergenic
1029459382 7:100686481-100686503 GCTGCAGCAGAGGGGGCCGCTGG - Intronic
1029465000 7:100720057-100720079 GCTGCTCCAGAGGCTGAAGCAGG + Intergenic
1029730126 7:102433487-102433509 GCAGCGGCTGCGGCGGCCGCGGG + Intronic
1030205350 7:106946950-106946972 GCTACTCCAGAGGCTGACGCAGG + Intergenic
1030369630 7:108684189-108684211 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1031604147 7:123748701-123748723 GCGGCGGCGGCGGCTGCTGCTGG + Exonic
1031966578 7:128031733-128031755 GCTGCGGCCGCCGCCGCCGCCGG - Intronic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032898548 7:136280109-136280131 GCTGCAGCAGTGGGTGCCCCAGG - Intergenic
1033119356 7:138653226-138653248 GCTGCTGGAGAAGCTGCAGCAGG + Intronic
1033394170 7:140957568-140957590 GCTGAGGGAGAAGCTGCAGCAGG + Intergenic
1033580765 7:142733208-142733230 CCTGAGGCAGAGGCTGCAACAGG - Intergenic
1033801435 7:144906920-144906942 GCTGCTGCGGAGGCTGAGGCAGG + Intergenic
1034398636 7:150846775-150846797 GCTGGGGCAGAGGTTGGGGCTGG + Intronic
1034414107 7:150955896-150955918 GCTGCGGGGGAGGGGGCCGCTGG - Intronic
1034978763 7:155462501-155462523 GCGGCGCCAGAGCCTGGCGCAGG + Exonic
1035010455 7:155711262-155711284 GCGGCTGCAGCGGCTGCGGCTGG - Exonic
1035693951 8:1579924-1579946 GCTGCAGCACAGGCAGCCGCAGG + Intronic
1035779519 8:2216764-2216786 GCTGCAGAAGACGGTGCCGCTGG - Intergenic
1036078009 8:5522588-5522610 GCTGCTGCAGAAGCTGGAGCTGG - Intergenic
1036125314 8:6056917-6056939 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1036642160 8:10591447-10591469 GCTGCCGCTGAGGCTGCCGCTGG - Intergenic
1036747488 8:11420243-11420265 GCAGCTGCAGAGGCTGGCGGGGG - Intronic
1036888715 8:12580543-12580565 GCTGCGGGGGAGGCTGAGGCAGG - Intergenic
1037130122 8:15398482-15398504 GCTGCTGAAGAGGCTGAGGCAGG + Intergenic
1037419575 8:18687877-18687899 GCTACTCCAGAGGCTGACGCAGG - Intronic
1037825243 8:22156636-22156658 GCTGCGGTAGCAGCTGCCGGTGG - Exonic
1037879426 8:22565760-22565782 GCGGCGGCCTCGGCTGCCGCTGG + Intronic
1037882264 8:22579060-22579082 GCGGCGGCAGGGGCGGCCCCGGG + Exonic
1038533558 8:28338012-28338034 TCTGGGGCAGAGGCTGCAACTGG - Intronic
1038535725 8:28351703-28351725 GCTGCTGCTGCTGCTGCCGCAGG - Exonic
1038786383 8:30620815-30620837 GCTGCTGAAGAGGCTGAGGCAGG + Intronic
1039174234 8:34784820-34784842 GCTACGCCAGAGGCTGAGGCAGG - Intergenic
1039453947 8:37696029-37696051 GCAGCGGCAGCGGCGGCGGCGGG + Exonic
1039467718 8:37796413-37796435 GCTCCGGTGGAGGCAGCCGCAGG - Intronic
1039516335 8:38136979-38137001 GCTGTGGGGGAGGCTGACGCAGG + Intronic
1039541815 8:38378528-38378550 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1040081421 8:43289763-43289785 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1040928786 8:52713768-52713790 GCTCCGGCCGAGGAAGCCGCAGG + Intronic
1041355300 8:56993636-56993658 GCTGCGGCGGCGGCGGCGGCGGG - Exonic
1041552677 8:59119253-59119275 GCGGCGGCAGCGGCGGCGGCGGG - Intergenic
1041730121 8:61054245-61054267 CCTGCGTCAGAGGCTGCTGCAGG - Intergenic
1042316800 8:67434709-67434731 GCTGCAGCAGTGGCAGCAGCAGG + Intronic
1042785094 8:72537380-72537402 GCAGCGGCGGCGGCGGCCGCGGG - Exonic
1042926164 8:73970920-73970942 GCTGCTCCAGAGGCTGAGGCAGG + Intronic
1043382552 8:79719376-79719398 GCTGCTGGGGAGGCTGACGCGGG - Intergenic
1044707965 8:95026354-95026376 GCTGCTCCAGAGGCTGACGTGGG + Intronic
1045356268 8:101392047-101392069 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1045501648 8:102748365-102748387 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1045850860 8:106696934-106696956 GCTGGGGCAGCAGCTGCCACAGG + Intronic
1046174403 8:110556319-110556341 GCAGCGGCAGCGGCAGCGGCAGG + Intergenic
1048484240 8:134832229-134832251 GCGGCGGCAGCGGCTCCCTCCGG + Intergenic
1049040874 8:140110956-140110978 GCTGCTGCAGGGGCTGCAGGGGG - Intronic
1049145187 8:140995269-140995291 GCTACTCCAGAGGCTGACGCAGG + Intronic
1049198516 8:141328509-141328531 GCTGAGGCAGGGGCTGCTGGGGG + Intergenic
1049245920 8:141562486-141562508 GCTGCGGCAGAGGGTGCCAGGGG - Intergenic
1049313603 8:141947126-141947148 GCTGGGACAGAGGCTGTAGCCGG + Intergenic
1049509779 8:143021744-143021766 GCTGCTGCTGAGCCTGCTGCCGG + Exonic
1049585114 8:143429392-143429414 GCGGCGGCGAAGGCTCCCGCGGG + Exonic
1049611614 8:143558597-143558619 GCTTCGGGAAAGGCTGCCCCTGG + Intronic
1049639146 8:143706704-143706726 GCTGCGGCAGAAGCCTCCCCGGG - Exonic
1049670479 8:143867343-143867365 GCTGCGGGAGAGGCTCCTGAAGG - Exonic
1049682069 8:143923715-143923737 GCTACAGCAGACGCTGCAGCAGG - Exonic
1049867370 8:144947514-144947536 GCTGCAGCACAGGCTGCCCCTGG - Intronic
1050341341 9:4642498-4642520 TCTTTGGCAAAGGCTGCCGCTGG - Intronic
1050455828 9:5833064-5833086 GCGGCGGCCGGGGCTGTCGCGGG - Exonic
1051928707 9:22360171-22360193 GCTGCTCCAGAGGCTGAGGCAGG + Intergenic
1052142416 9:25003856-25003878 GCTGAGGCAGAGGGTGGCGGGGG + Intergenic
1052363928 9:27589927-27589949 CCTCAGGCAGAGGCTGCGGCTGG - Intergenic
1052973095 9:34390729-34390751 GCTGCTGCGGAGGCTGAAGCAGG - Intronic
1053786372 9:41655359-41655381 GCGGCTGCGGAGGCTGGCGCGGG - Intergenic
1054158691 9:61658858-61658880 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054175091 9:61869315-61869337 GCGGCTGCGGAGGCTGGCGCGGG - Intergenic
1054478465 9:65589863-65589885 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054662446 9:67711478-67711500 GCGGCTGCGGAGGCTGGCGCGGG + Intergenic
1054765239 9:69037352-69037374 GCTACTCCAGAGGCTGCGGCAGG + Intronic
1054870294 9:70043059-70043081 GCTGCGGCAGCAGCAGCCTCTGG + Intergenic
1054878471 9:70121078-70121100 GCTGAGTCAGAGGATGCCTCTGG + Intronic
1055699417 9:78926577-78926599 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1056154053 9:83817561-83817583 GCCGCGGGAGAGGCGGCGGCGGG - Exonic
1056356444 9:85805532-85805554 GCCGCGGGAGAGGCGGCGGCGGG + Intergenic
1056589140 9:87951551-87951573 CCTTGGGCAGAGGCTGCAGCTGG + Intergenic
1056756102 9:89382950-89382972 GCTGGGGCTGAGTCTCCCGCAGG - Intronic
1057216948 9:93234431-93234453 GCTGCGGCCGAGCCTGTGGCAGG + Intronic
1057313378 9:93954989-93955011 GCCGCGGCAGCGGCGGCTGCGGG + Exonic
1057334155 9:94142768-94142790 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1057403500 9:94745385-94745407 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1057489190 9:95508557-95508579 GCTGCGGCCGCGGCCGCTGCCGG + Exonic
1057996131 9:99822760-99822782 GCGGCGGCAGCGGCAGCGGCAGG + Intronic
1058446556 9:105060363-105060385 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1058885389 9:109319122-109319144 GCTGCGGCAGACGGTGCCTTCGG - Intronic
1060556827 9:124512340-124512362 ACTGCAGCTGAGGCTCCCGCTGG - Intergenic
1060811700 9:126614138-126614160 GCTGCTGCAGACGGAGCCGCGGG - Intergenic
1060827172 9:126693889-126693911 GCTGGGGCAGAGGCTGGGGCTGG + Intronic
1060889206 9:127177544-127177566 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
1061137154 9:128741499-128741521 GCTGAGGCAGCTGCTGCTGCAGG + Intronic
1061544493 9:131296636-131296658 GCTGCGGCAGAGGCTCTTCCTGG - Intronic
1062008105 9:134251668-134251690 GCTGCTGCAGAGGCTGCATTTGG + Intergenic
1062065874 9:134525938-134525960 GCCGCAGCGCAGGCTGCCGCCGG - Intergenic
1062107661 9:134764487-134764509 GCTGGGGCAGAGTCTGCTGGAGG - Intronic
1062312247 9:135945119-135945141 GCTGCCTCCGAGGCTGCCGCGGG - Exonic
1062388082 9:136322733-136322755 GCTGCCCCAGAGGCTGTCCCTGG + Intergenic
1062545146 9:137059146-137059168 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1062658163 9:137614712-137614734 GCTGAGGCTGAGGCTGCGGCTGG + Exonic
1185872072 X:3672913-3672935 GAGGCGGCAGAGGCTGCAGTGGG + Intronic
1185915794 X:4034003-4034025 GCTGCTGCGGAGGCTGAGGCAGG - Intergenic
1185943238 X:4344777-4344799 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1186662202 X:11680095-11680117 GCTACTGCAGAGGCTGAGGCAGG - Intergenic
1186781506 X:12916559-12916581 GCTCCTGCAGAGGCAGCCACAGG - Intronic
1187181443 X:16946892-16946914 GCAGCGGCAGCGGCAGCGGCGGG + Exonic
1187507206 X:19887478-19887500 GCAGCAGCAGAGGCAGCAGCGGG - Exonic
1188250409 X:27886722-27886744 GCTACTGCAGAGGCTGAGGCAGG + Intergenic
1188691198 X:33131188-33131210 GCTGCGGCTGCTGCTGCTGCTGG + Intronic
1188835457 X:34948713-34948735 GCTGCTGCAGCAGCTGCTGCTGG + Intergenic
1188941390 X:36241811-36241833 ACTTGGGCAGAGGCTGCAGCAGG - Intronic
1190337462 X:49270769-49270791 GCTGCGGCAGCTGCTGCTGCTGG - Exonic
1192165084 X:68823132-68823154 GTTAAGGCAGGGGCTGCCGCAGG + Intergenic
1192361649 X:70444744-70444766 GCAGCGGCAGCGGCGGCGGCAGG - Intergenic
1192440395 X:71169770-71169792 GCTGAGGGCTAGGCTGCCGCAGG - Exonic
1192630751 X:72776607-72776629 GAAGCTGCAGAGGCAGCCGCTGG + Intergenic
1192650959 X:72944197-72944219 GAAGCTGCAGAGGCAGCCGCTGG - Intergenic
1195066180 X:101240333-101240355 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1195095088 X:101494026-101494048 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1195095095 X:101494044-101494066 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1195095109 X:101494080-101494102 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1195702615 X:107716439-107716461 GCAGCCGCAGAGGCAGCCGGAGG - Intronic
1195884424 X:109624668-109624690 GCCGACGCCGAGGCTGCCGCGGG - Exonic
1195891379 X:109699253-109699275 GCTACGGGGGAGGCTGCGGCAGG + Intronic
1195954879 X:110318142-110318164 GCTGCGGCTCAGGCCGCCGGGGG + Exonic
1196684067 X:118495881-118495903 GCAGCGGCCGCGGCCGCCGCGGG + Intronic
1197872078 X:131070206-131070228 ACTGCGGCTGAGGCTTCTGCAGG + Intronic
1197939359 X:131773676-131773698 GCTGCTCCAGAGGCTGAGGCAGG - Intergenic
1198312622 X:135436616-135436638 CCTCCGGCAGAGGCTGCTGAAGG + Intergenic
1199419102 X:147622491-147622513 GCTGCTGGAGAGGCTGAGGCAGG - Intergenic
1199649928 X:149940295-149940317 GCTGGGGCTGTGGCTGCAGCGGG + Intergenic
1199986610 X:152957177-152957199 GCTGCTCCAGAGGCTGAGGCAGG - Intronic
1201868208 Y:18677537-18677559 GCTACTGCAGAGGCTGAAGCAGG - Intergenic