ID: 976775602

View in Genome Browser
Species Human (GRCh38)
Location 4:88702869-88702891
Sequence CTGAATATTCCTATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 249}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976775600_976775602 -9 Left 976775600 4:88702855-88702877 CCACTTGTGAGAGACTGAATATT 0: 1
1: 0
2: 1
3: 21
4: 336
Right 976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG 0: 1
1: 0
2: 3
3: 43
4: 249
976775598_976775602 28 Left 976775598 4:88702818-88702840 CCCAAAATGTTTATGTCTAGGTT 0: 1
1: 0
2: 2
3: 67
4: 752
Right 976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG 0: 1
1: 0
2: 3
3: 43
4: 249
976775595_976775602 30 Left 976775595 4:88702816-88702838 CCCCCAAAATGTTTATGTCTAGG 0: 1
1: 0
2: 1
3: 18
4: 249
Right 976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG 0: 1
1: 0
2: 3
3: 43
4: 249
976775597_976775602 29 Left 976775597 4:88702817-88702839 CCCCAAAATGTTTATGTCTAGGT 0: 1
1: 0
2: 1
3: 18
4: 392
Right 976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG 0: 1
1: 0
2: 3
3: 43
4: 249
976775599_976775602 27 Left 976775599 4:88702819-88702841 CCAAAATGTTTATGTCTAGGTTC 0: 1
1: 0
2: 1
3: 20
4: 384
Right 976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG 0: 1
1: 0
2: 3
3: 43
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976775602 Original CRISPR CTGAATATTCCTATGGACAA TGG Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903986524 1:27233292-27233314 CTGAATACTCCCAGAGACAAAGG - Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904545171 1:31264724-31264746 CTGAATAGTCCTATAGGCTACGG - Intronic
905116385 1:35644688-35644710 ATGAATATTGGTATGTACAAAGG - Intergenic
907262132 1:53227021-53227043 CTGAATATTGGTGTGGACATGGG - Exonic
907812149 1:57881978-57882000 CTGAATATTTCTGTGGGGAAGGG - Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
907845893 1:58206348-58206370 ATGAATTTTCCTGTGGACAAAGG - Intronic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
910751570 1:90636824-90636846 CTGAATATTCCTATTTACACTGG + Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
911961859 1:104314679-104314701 CTGAATAATCATATTGTCAATGG - Intergenic
913283631 1:117208525-117208547 CTGAATATTGCACTAGACAATGG - Intronic
913503589 1:119495309-119495331 CTGAAGATTCCACTGGAGAAAGG + Intergenic
913723876 1:121630690-121630712 TTGAACATTTCTATGGAAAAGGG - Intergenic
913729570 1:121696006-121696028 TTGAACATTCCGATGGAAAAGGG - Intergenic
913729726 1:121697872-121697894 TTGAACATTCCGATGGAAAAGGG - Intergenic
913729882 1:121699738-121699760 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730039 1:121701604-121701626 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730195 1:121703470-121703492 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730656 1:121709068-121709090 TTGAACATTCCGATGGAAAAGGG - Intergenic
913730809 1:121710934-121710956 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731117 1:121714666-121714688 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731266 1:121716532-121716554 TTGAACATTCCGATGGAAAAGGG - Intergenic
913731879 1:121723994-121724016 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732339 1:121729591-121729613 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732492 1:121731456-121731478 TTGAACATTCCGATGGAAAAGGG - Intergenic
913732639 1:121733321-121733343 TTGAACATTCCGATGGAAAAGGG - Intergenic
913740795 1:121841944-121841966 TTGAACATTTCTATGGAAAAGGG - Intergenic
913745110 1:121894434-121894456 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745265 1:121896300-121896322 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745830 1:121903336-121903358 TTGAACATTCCGATGGAAAAGGG - Intergenic
913745987 1:121905202-121905224 TTGAACATTCCGATGGAAAAGGG - Intergenic
913746625 1:121913010-121913032 TTGAACATTCCGATGGAAAAGGG - Intergenic
913748932 1:121939777-121939799 TTGAACATTCCGATGGAAAAGGG - Intergenic
913749830 1:121950734-121950756 TTGAACATTCCGATGGAAAAGGG - Intergenic
913749983 1:121952599-121952621 TTGAACATTCCGATGGAAAAGGG - Intergenic
913750479 1:121959321-121959343 TTGAACATTCCGATGGAAAAGGG - Intergenic
913750633 1:121961187-121961209 TTGAACATTCCGATGGAAAAGGG - Intergenic
913751925 1:122027764-122027786 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752082 1:122029631-122029653 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752235 1:122031496-122031518 TTGAACATTCCGATGGAAAAGGG + Intergenic
913752391 1:122033364-122033386 TTGAACATTCCGATGGAAAAGGG + Intergenic
913753716 1:122048636-122048658 TTGAACATTCCGATGGAAAAGGG + Intergenic
913753873 1:122050501-122050523 TTGAACATTTCTATGGAAAAGGG + Intergenic
913754360 1:122056105-122056127 TTGAACATTCCAATGGAAAAGGG + Intergenic
913755643 1:122071116-122071138 TTGAACATTCCGATGGAAAAGGG + Intergenic
913755949 1:122074847-122074869 TTGAACATTTCTATGGAAAAGGG + Intergenic
913756436 1:122080445-122080467 TTGAACATTCCGATGGAAAAGGG + Intergenic
913756919 1:122086216-122086238 TTGAACATTCCGATGGAAAAGGG + Intergenic
913757250 1:122089948-122089970 TTGAACATTCCGATGGAAAAGGG + Intergenic
913758420 1:122103555-122103577 TTGAACATTCCGATGGAAAAGGG + Intergenic
913758741 1:122107290-122107312 TTGAACATTTCTATGGAAAAGGG + Intergenic
913759415 1:122115011-122115033 TTGAACATTCCGATGGAAAAGGG + Intergenic
913761392 1:122137744-122137766 TTGAACATTCCGATGGAAAAGGG + Intergenic
913762033 1:122145211-122145233 TTGAACATTCCGATGGAAAAGGG + Intergenic
913763001 1:122156405-122156427 TTGAACATTCCGATGGAAAAGGG + Intergenic
913763335 1:122160136-122160158 TTGAACATTCCGATGGAAAAGGG + Intergenic
913764792 1:122177140-122177162 TTGAACATTCCGATGGAAAAGGG + Intergenic
913765276 1:122182739-122182761 TTGAACATTCCGATGGAAAAGGG + Intergenic
913766028 1:122191729-122191751 TTGAACATTTCTATGGAAAAGGG + Intergenic
913766187 1:122193596-122193618 TTGAACATTCCGATGGAAAAGGG + Intergenic
913766357 1:122195462-122195484 TTGAACATTTCTATGGAAAAGGG + Intergenic
913768124 1:122216000-122216022 TTGAACATTTCTATGGAAAAGGG + Intergenic
913768610 1:122221602-122221624 TTGAACATTCCGATGGAAAAGGG + Intergenic
913777900 1:122345615-122345637 TTGAATATTTCGATGGAAAAGGG + Intergenic
913780557 1:122381063-122381085 TTGAATATTTCGATGGAAAAGGG + Intergenic
913781962 1:122399730-122399752 TTGAATATTTCGATGGAAAAGGG + Intergenic
913784456 1:122432984-122433006 TTGAATATTTCGATGGAAAAGGG + Intergenic
913788803 1:122491194-122491216 TTGAATATTTCGATGGAAAAGGG + Intergenic
914788823 1:150858360-150858382 CTTAATAGCCCTCTGGACAATGG + Exonic
915631973 1:157159726-157159748 CTGAAAATTCATATGGACTAAGG + Intergenic
915738362 1:158098961-158098983 CTGAACATTGCTATGAACATAGG - Intronic
917049001 1:170897070-170897092 GTGACTATTCCTATCCACAAGGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922409102 1:225352601-225352623 ATCAATACTCCTATGGAAAATGG - Intronic
924077240 1:240352937-240352959 CTGAATAATCCCAGTGACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
1063336008 10:5214536-5214558 CTGAATATTCATATGGTCTATGG - Intronic
1064276734 10:13913258-13913280 CAGTATTTTCCTAGGGACAAAGG + Intronic
1064645104 10:17453279-17453301 CTGAGTTTTCCTCTCGACAATGG - Intronic
1066056718 10:31688329-31688351 CTGTGTATTGCTATGGACTATGG - Intergenic
1066196521 10:33105807-33105829 CTGAATACGCCTATGGAAGAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067754566 10:48995304-48995326 CAGAAAACTTCTATGGACAAAGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1071918587 10:90324641-90324663 TTGATTATTCTTATGGACTATGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1079624563 11:22600252-22600274 CTGAAACTTCCTATGGAATATGG + Intergenic
1081068552 11:38578887-38578909 CTGAATATTACCATAAACAATGG + Intergenic
1081239757 11:40690549-40690571 CTGAATATGCCAATGTAAAATGG - Intronic
1082554414 11:54543999-54544021 TTGAAGATTTCTATGGAAAAGGG + Intergenic
1082570386 11:54730949-54730971 CAGAAAATTTGTATGGACAATGG + Intergenic
1082617827 11:55383028-55383050 CAGATTATTACTATGGACTATGG + Intergenic
1085062091 11:73456670-73456692 TGGAGGATTCCTATGGACAAAGG - Intronic
1085065038 11:73487404-73487426 CTGAATGTTTTTATGGAGAAGGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1090691124 11:129183133-129183155 CTAAATATTCCTATGAACGTGGG + Intronic
1091404433 12:200411-200433 CTGAATATTCTTATGTAAACCGG + Intronic
1091579007 12:1769463-1769485 GTGAATATTCCTTTATACAAGGG + Intronic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094119472 12:26954833-26954855 CAGAATATTCCCATGGGCCACGG + Intronic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1098387333 12:69933383-69933405 CTGACTATTCATATGGTGAAAGG + Intronic
1098409124 12:70160760-70160782 CTGGATATTCATATGCAGAAGGG + Intergenic
1098759963 12:74410989-74411011 CTGAAAATATCCATGGACAATGG - Intergenic
1100263690 12:92955903-92955925 GTAAATATTTCTATGTACAAAGG - Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107015917 13:35707588-35707610 CTGAATTGTCATAAGGACAAAGG - Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110838798 13:80117180-80117202 CTGAATTTTTCTTTGAACAATGG + Intergenic
1112978164 13:105346764-105346786 GGGAGTATTCCTATGGACATAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1116370456 14:44123915-44123937 CTTAATATTACTATATACAAAGG - Intergenic
1122450581 14:101803352-101803374 CTGGATATTCATATGCAGAATGG + Intronic
1125788937 15:42348176-42348198 CTGAATCCTCCTATGGACTCCGG + Exonic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1138027293 16:53532050-53532072 CTGAATATCCCAAGGGACACAGG + Intergenic
1141520508 16:84575743-84575765 CTGGAGATGCCTGTGGACAAGGG - Intronic
1143589121 17:7870056-7870078 CTGAATAATCCTATACAAAATGG - Intronic
1143960702 17:10716048-10716070 CTGAATATTGATGTGGACATGGG - Intronic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145678019 17:26548930-26548952 CTGAGTATTTCTTTGGAAAAGGG + Intergenic
1148667169 17:49383366-49383388 CTGAATATTCCCATGGAAACTGG - Intronic
1149667014 17:58371993-58372015 CTGAATAATCCTATGGTCCAGGG + Intronic
1153359623 18:4179257-4179279 CAGATGATTCCTATGAACAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155768973 18:29672800-29672822 CTGAACATTCCTATTGGCAGTGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158837327 18:61344827-61344849 CAGAAAATTCCAATGGTCAAGGG + Intronic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159106426 18:64006259-64006281 CAGAATATACCTATGTACTAAGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1163814603 19:19456789-19456811 CTGAAGATTCCAAAGGACATGGG - Intronic
1168515294 19:57005850-57005872 TTGATTCTTCCTATTGACAAAGG - Intergenic
925931423 2:8711239-8711261 CTGAATATTACTAAGCTCAAGGG + Intergenic
925984372 2:9204156-9204178 CAGAAGATTCCTTTGGAAAATGG + Intergenic
927296037 2:21454117-21454139 CTGAACATTCCTAGAGACACTGG + Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929952291 2:46422846-46422868 CTAAATAATCCCATGAACAATGG + Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
934921654 2:98348722-98348744 CTGAATATTTCTGAGTACAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935401972 2:102669693-102669715 CTGATGATTCCTATGGACAACGG + Intronic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
938999507 2:136717777-136717799 CTGAATATTCCAATAGATGATGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
942069365 2:172301875-172301897 ATGAATTTTCCTAAGGATAAAGG - Intergenic
942694275 2:178621874-178621896 CTGAATATTCCTGTGAAGTAAGG - Exonic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943913710 2:193601338-193601360 CTGAATATTACTAAGGAAGATGG + Intergenic
944188014 2:196971035-196971057 TTGAATATGCCTATGGACAAGGG - Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947681701 2:232039716-232039738 CTTAATATTCCAATTGACAAAGG - Intronic
947948956 2:234131175-234131197 TTGAATATTACTCTGGGCAATGG + Intergenic
1169298202 20:4418376-4418398 CTGAATATTTCTTTAGAGAAAGG + Intergenic
1172926920 20:38546230-38546252 CTGCATAATGCTATGGAGAATGG - Exonic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176152610 20:63599988-63600010 ATGAATTTGACTATGGACAATGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178533120 21:33391793-33391815 CTGACTTCTGCTATGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
949216860 3:1581374-1581396 CAGAATATTCCTAGGTACAATGG + Intergenic
951268919 3:20602176-20602198 CTGAACATTCCCATTGGCAATGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956712620 3:72051636-72051658 CTGAAGATCCCGATGGACGAAGG + Intergenic
957495457 3:80986034-80986056 CTGTATATTACAATGAACAATGG - Intergenic
959080557 3:101796359-101796381 CTTAATTTTCCTAAAGACAAGGG - Intronic
959900510 3:111656170-111656192 CTGAAAAATCCTATGAAAAATGG + Intronic
963596091 3:147326828-147326850 ATGAATATTCCTACTGAAAAGGG + Intergenic
963667772 3:148211419-148211441 CAGAATATTTCTATAAACAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
969591523 4:8124725-8124747 GTGAATATTCGTGTGGACATAGG + Intronic
970505488 4:16725319-16725341 TTGAATATGCCAATAGACAATGG + Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971976095 4:33689378-33689400 CTGGATATTTTTAGGGACAATGG - Intergenic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976887412 4:90002689-90002711 CTGAAATTTCCTTTGTACAAAGG + Intergenic
978491299 4:109314669-109314691 CTGTATATTCCTTTGCACAAGGG + Intergenic
979041447 4:115802418-115802440 CTGAATATTTGTATGAAAAATGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
980167647 4:129248643-129248665 CTGAATATTCCTGAGGACTGGGG + Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981846209 4:149173089-149173111 CTGACTATGCCTATGCCCAAGGG - Intergenic
981871074 4:149486840-149486862 CTGAATCTTCCCTTGGCCAAAGG - Intergenic
982504651 4:156201642-156201664 CTGGATATTCCCATGCACAATGG + Intergenic
983547704 4:168980026-168980048 ATGATTATTCTGATGGACAATGG + Intronic
983614514 4:169687013-169687035 CAGAATAATCATGTGGACAAAGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987972016 5:24959149-24959171 CTGAATTTTCCCAGGGACCAAGG + Intergenic
989229631 5:39072234-39072256 CTGGAAATACCTATGGACATAGG + Intronic
990807387 5:59680921-59680943 CTGAATATACCCATGGATATAGG + Intronic
992226527 5:74624358-74624380 TTGAATATACCCATGGATAATGG - Intergenic
993290010 5:86054929-86054951 CTAAATATACCTATGGAAGATGG - Intergenic
995159117 5:108954883-108954905 CTGTATATTCTGATGGACAGAGG + Exonic
995243689 5:109913721-109913743 CTGCATATATCTATGGACAAGGG + Intergenic
995266404 5:110166737-110166759 TAGAATATTTCAATGGACAATGG - Intergenic
996095390 5:119393032-119393054 CTGATTATTCCTATAAAGAATGG - Exonic
996658275 5:125967564-125967586 ATGAGTATTGCAATGGACAAAGG + Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
998222800 5:140301221-140301243 ATGAATATTACTATAGACAGTGG - Intronic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003537346 6:6987000-6987022 TTGAATATTTCTATGGACTGAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009325033 6:62338815-62338837 CTGAATATTCCTATTGGCAATGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011720644 6:90152878-90152900 GTGAATATTACTATGGATAATGG + Intronic
1012393336 6:98768277-98768299 ATGAATAACCCTATTGACAATGG - Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014400322 6:120981045-120981067 CTGCAGATTCCAAGGGACAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020123868 7:5521533-5521555 AGGAATATTCCGAGGGACAATGG - Intergenic
1020947835 7:14637154-14637176 CTGAGTATTCCTTTGTACACGGG - Intronic
1021954167 7:25807226-25807248 TTGCATAATCCTATGGAAAAGGG + Intergenic
1023824440 7:43999641-43999663 CTGAAGATGCTTTTGGACAATGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1026087989 7:67278405-67278427 CTGAAGATGCTTTTGGACAATGG + Intergenic
1026726252 7:72871868-72871890 CTGAAGATGCTTTTGGACAATGG - Intergenic
1027117592 7:75493740-75493762 CTGAAGATGCTTTTGGACAATGG + Intergenic
1027327655 7:77060798-77060820 CTGAAGATGCTTTTGGACAATGG - Intergenic
1028074185 7:86490964-86490986 CTGAATATTAATATGTACATTGG - Intergenic
1028281285 7:88932235-88932257 ATGAGTATTCTTATGTACAATGG - Intronic
1028471356 7:91210089-91210111 CAGCATATTCCTATGTATAAGGG - Exonic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029719908 7:102356309-102356331 CTGAAGATGCTTTTGGACAATGG - Intergenic
1029752705 7:102552948-102552970 CTGAAGATGCTTTTGGACAATGG + Exonic
1029770656 7:102652041-102652063 CTGAAGATGCTTTTGGACAATGG + Exonic
1030448051 7:109672326-109672348 CTGAACATGCTTCTGGACAAAGG + Intergenic
1031340116 7:120589803-120589825 CAGTTTATTCCTATGGAAAATGG + Intronic
1033556690 7:142494363-142494385 CTGAATCTTGGAATGGACAAAGG - Intergenic
1034055220 7:148027220-148027242 CTGAATAGGCCTATGGAGAAAGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1036014192 8:4763231-4763253 CTGAAAACTCTTTTGGACAAAGG + Intronic
1037686547 8:21144461-21144483 CTGTATATTCCTATAGAAATTGG - Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043559841 8:81479582-81479604 CAAAATATTCCTTTGAACAAAGG - Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044777219 8:95702787-95702809 CTGGATTTTCCTATGTACAAGGG - Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050978726 9:11979391-11979413 TTGAATATTCCTATTGCTAATGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1055229587 9:74045563-74045585 CTCAATATTGCTTTGGCCAATGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059963885 9:119594380-119594402 GTGAATATTCCTATTAACTAGGG + Intergenic
1059980971 9:119771525-119771547 CTGAGTGCTCCTGTGGACAATGG - Intergenic
1060759786 9:126237563-126237585 GTGAATACTACTATGGAAAAAGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1203338948 Un_KI270302v1:2246-2268 TTGAATATTTCGATGGAAAAGGG + Intergenic
1186232343 X:7468964-7468986 CTGAATGTTCCTATGCACCTTGG + Intergenic
1186397846 X:9227809-9227831 CAGAATATTCCTGGGGACTAGGG + Intergenic
1186596450 X:10986810-10986832 CTGAAAATTCCTTTGGGTAAGGG + Intergenic
1187874448 X:23792527-23792549 CTGAGTATTGCTATTAACAACGG - Intergenic
1188149893 X:26659930-26659952 CTGAATATTCATGTGCAAAATGG + Intergenic
1193067616 X:77275957-77275979 CTGAACATTCCTATTGGCAGAGG + Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1197610695 X:128635009-128635031 CATAATACTGCTATGGACAAAGG - Intergenic
1199548320 X:149031614-149031636 CTGGATATTCCAATGCACGAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201440061 Y:13998657-13998679 GTGAATATTACCATGGTCAATGG + Intergenic
1201444510 Y:14044051-14044073 GTGAATATTACCATGGTCAATGG - Intergenic
1201476278 Y:14385338-14385360 GTGAATATTTCTATGCACATTGG - Intergenic
1201577626 Y:15477877-15477899 AAGAATCTTCCTAAGGACAATGG + Intergenic