ID: 976775997

View in Genome Browser
Species Human (GRCh38)
Location 4:88706794-88706816
Sequence CTGGATGACAATCTGCAGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 232}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976775997_976776000 -7 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976776000 4:88706810-88706832 CATCCAGTCCACAGCCAGCGGGG 0: 1
1: 0
2: 12
3: 27
4: 250
976775997_976776005 8 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976776005 4:88706825-88706847 CAGCGGGGAGGAGTACTTGCCGG 0: 1
1: 0
2: 0
3: 12
4: 109
976775997_976776002 -4 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976776002 4:88706813-88706835 CCAGTCCACAGCCAGCGGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 248
976775997_976775999 -8 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976775999 4:88706809-88706831 TCATCCAGTCCACAGCCAGCGGG 0: 1
1: 0
2: 0
3: 21
4: 205
976775997_976776006 11 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976776006 4:88706828-88706850 CGGGGAGGAGTACTTGCCGGTGG 0: 1
1: 0
2: 0
3: 6
4: 62
976775997_976775998 -9 Left 976775997 4:88706794-88706816 CCAGTCTGCAGATTGTCATCCAG 0: 1
1: 0
2: 1
3: 15
4: 232
Right 976775998 4:88706808-88706830 GTCATCCAGTCCACAGCCAGCGG 0: 1
1: 0
2: 1
3: 8
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976775997 Original CRISPR CTGGATGACAATCTGCAGAC TGG (reversed) Exonic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901134961 1:6987096-6987118 AGTGATGACAATATGCAGACAGG - Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
903785812 1:25860516-25860538 CTGGCTGACCTGCTGCAGACTGG - Intergenic
904370118 1:30042904-30042926 TGGGATGACCAGCTGCAGACAGG + Intergenic
904945111 1:34193530-34193552 CTGGATAACAATCTCCTGAAAGG + Intronic
905482404 1:38270660-38270682 CTGGCTGGGATTCTGCAGACAGG + Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907374701 1:54026484-54026506 CTGGAAGACAACCTTCAGAATGG - Intergenic
907663640 1:56415771-56415793 CAGGATGGCTACCTGCAGACAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
910077429 1:83297791-83297813 TGGCATGACAATCTGTAGACTGG + Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
915511670 1:156390123-156390145 CTGGATGAGGAGCTGCAGAAAGG - Intergenic
916202301 1:162283731-162283753 CTGGAACACCACCTGCAGACTGG - Intronic
917371775 1:174301057-174301079 ATCCATGACAAACTGCAGACCGG - Intronic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919606072 1:199686349-199686371 CTGGATGATACTCTGAGGACAGG - Intergenic
919642562 1:200059586-200059608 TTGTATGACAGTGTGCAGACAGG - Intronic
919939078 1:202274046-202274068 CTGGGTGGGCATCTGCAGACGGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921813074 1:219536447-219536469 CTGAAGAACAATCTGCAGCCTGG + Intergenic
921831573 1:219733222-219733244 GTGGAGGACAATCTCCAGAAGGG + Intronic
921984946 1:221302799-221302821 CTGTTTGAAAATCTGCAGCCTGG - Intergenic
924132201 1:240922425-240922447 CTGAAAGACAAACTACAGACTGG + Intronic
924791716 1:247256653-247256675 CTGTATGACAAACAGAAGACTGG - Intergenic
1066207732 10:33206182-33206204 CTGGATGCGAATCTGTAGCCTGG - Intronic
1067576643 10:47412937-47412959 CTGAATGCCATTCTGCAGTCAGG + Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068858434 10:61821597-61821619 CTGGATCACAAGCTGCTGAACGG + Intergenic
1071957112 10:90771082-90771104 CGGGATGACCAGCTGCAGACAGG + Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1077012835 11:386427-386449 CGGGATGACCAGCTGCAGAAAGG + Intergenic
1078838421 11:15054554-15054576 CTGGAAGACAATCTGTGGATGGG + Intronic
1079085165 11:17440012-17440034 CTGGATTCCAAACTGCAGCCTGG - Intronic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083374587 11:62209185-62209207 CTGGGTCACACTCTGCAGCCTGG - Intronic
1085183864 11:74559038-74559060 CTGGGTGACAATCGGTACACAGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087045610 11:93841567-93841589 CTGAATGAGAAACTGGAGACCGG - Intronic
1090136982 11:124209397-124209419 CTGGGTGACCACCTGCAGAGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1093463963 12:19431687-19431709 TTGGATTACAATCTACAGAATGG + Intronic
1095826131 12:46531615-46531637 CAGGATGACCATCTGCAGAGAGG + Intergenic
1098389467 12:69953742-69953764 CTGGATGACAAAGTGCAACCCGG + Intronic
1102599977 12:114022277-114022299 ATGGATGCCGATCTTCAGACAGG + Intergenic
1103434542 12:120914773-120914795 CTCAATGATAATCTGCAGAAGGG + Intergenic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106564865 13:30875405-30875427 CTGAAGGACAATATGCAGAGGGG - Intergenic
1106771750 13:32968083-32968105 CTGAATAACAACCTGCAGATTGG - Intergenic
1106906496 13:34414935-34414957 GTGGATGATAATCTGCAGAATGG - Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1109324158 13:60847642-60847664 ATAGAAAACAATCTGCAGACTGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1110005343 13:70259400-70259422 TTGGAAGGCAAACTGCAGACTGG + Intergenic
1115216012 14:31014850-31014872 CTGGGTGACAGACTGCAGCCTGG - Intronic
1115601538 14:34960325-34960347 CTGAATAACAAGCTGCATACTGG - Intergenic
1115627900 14:35213399-35213421 CAGGATCTCACTCTGCAGACTGG - Intronic
1117213502 14:53526272-53526294 CATGGTGACAATCTGCAGGCTGG - Intergenic
1119873926 14:78040736-78040758 CTGGGGGACAATCTGGAGGCTGG - Intergenic
1120057213 14:79938563-79938585 CTTGATGCCAATCTGATGACAGG - Intergenic
1120981391 14:90292399-90292421 CTGGAAGACAATCTCCAGAGGGG + Intronic
1121188771 14:92003982-92004004 CTCTAAGACACTCTGCAGACTGG + Exonic
1122182454 14:99966213-99966235 CTGTATGACAGTCGACAGACAGG - Intergenic
1127861254 15:62996275-62996297 CTGGATGAGAATCTTCAGGGTGG - Intergenic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128730872 15:70020126-70020148 CTGGATGAAGAACTGTAGACAGG + Intergenic
1128847887 15:70917506-70917528 TGGGATGACCATCTGCAGAGAGG + Intronic
1131686723 15:94775970-94775992 CTGGATGGCTATCTGAAGAGGGG - Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137334297 16:47533188-47533210 CGGGATGACTAGCTGCAGAGAGG - Intronic
1137339564 16:47587207-47587229 CTGGATTAAAATATGAAGACAGG - Intronic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138397760 16:56719090-56719112 ATGGAAAACAATCTGCAGAATGG + Intronic
1140561461 16:75987050-75987072 CACAATGACAATCTGCAGAATGG + Intergenic
1141770047 16:86084442-86084464 CAGAATCACAATCTGCACACAGG + Intergenic
1141816740 16:86415766-86415788 CTGGATGAAATGCTGCAAACGGG + Intergenic
1141915034 16:87089946-87089968 CAGGATGACAGTCTGCACATGGG + Intronic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1144073361 17:11694453-11694475 CTGGAGGAGCATCTGCAGAAAGG + Intronic
1146093524 17:29905872-29905894 CTGGATGACTAACTGCAGAAAGG + Intronic
1149085491 17:52710421-52710443 CTGGAGGACATGCTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1151841071 17:76617802-76617824 CTGGATGAATAACTTCAGACTGG + Intergenic
1151955617 17:77378754-77378776 CTGGCTGACATTCTGGAGGCTGG + Intronic
1153170926 18:2314845-2314867 CTGGATCTCCATCTGCAGGCTGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1157628763 18:49075417-49075439 TTGGATGAAAATCTGAAGAGAGG - Intronic
1159941922 18:74414881-74414903 CTGGCTGAAGCTCTGCAGACTGG + Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1163457005 19:17412899-17412921 CAGGATGAAATTCAGCAGACTGG + Intronic
1166007738 19:39918631-39918653 CTGGTTGTCAACCTGCAGAGTGG + Exonic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925154611 2:1639798-1639820 CCAGATGACAATCTGCACTCTGG + Intronic
926139960 2:10362623-10362645 CAGGCTGATTATCTGCAGACCGG + Intronic
926268687 2:11348132-11348154 CTGAATGACAAGCAACAGACTGG - Intronic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
930024150 2:47020257-47020279 CTGGAAGACAAGCCCCAGACAGG - Intronic
930592700 2:53348182-53348204 CTGGATGTCCATATGCAGAAGGG - Intergenic
933424094 2:82087780-82087802 CTGTATGACATTCTTCAAACTGG + Intergenic
933801123 2:85961227-85961249 CAGGATGACCAGCTGCAGAAAGG - Intergenic
934865769 2:97809022-97809044 CTGGAGGCCAACCCGCAGACTGG - Intronic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
937152743 2:119697043-119697065 CTGGCTGACCAGCTGCAGGCTGG + Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
937990389 2:127658999-127659021 GTGGTTGACACTCTTCAGACTGG - Intronic
940739842 2:157494508-157494530 CTGGATGACATTCTGCATTGAGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
942379921 2:175378589-175378611 CTGGGAAACAAGCTGCAGACAGG + Intergenic
943809942 2:192172263-192172285 CAGGATCAGAATCTGCAGAAGGG - Intronic
943961236 2:194265342-194265364 TGGGATGACAAGCTGCAGAGAGG + Intergenic
944490861 2:200256460-200256482 CTGGAGGACAAACTGAAGGCAGG - Intergenic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
947572253 2:231245386-231245408 CTGGATGACAGTCTGCTGTCGGG + Intronic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1168841443 20:912487-912509 ATGGATGAGAAGCTGCAGGCAGG - Intronic
1169124066 20:3114619-3114641 CCGGATGTCAGACTGCAGACTGG + Intronic
1171495830 20:25554442-25554464 CAGAATGGCAATCTGCATACTGG + Intronic
1172580390 20:36042830-36042852 TGGGATGCCAAACTGCAGACAGG + Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1176408436 21:6434443-6434465 TGGGATGACCACCTGCAGACAGG + Intergenic
1179683929 21:43042769-43042791 TGGGATGACCACCTGCAGACAGG + Intergenic
1180543657 22:16478079-16478101 CAGGATGACAATAATCAGACGGG - Intergenic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
953447948 3:42983502-42983524 CTGGACGAACATCTGCAGGCTGG - Intronic
954099334 3:48357515-48357537 CAGGATGACTAGCTGCAGATTGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
958900071 3:99875959-99875981 CAGCATCACAAACTGCAGACAGG - Intronic
959930145 3:111971680-111971702 CTGGATGACTGCCTGCGGACTGG - Intronic
960333882 3:116392840-116392862 CGGGATGACAAGCTACAGAGAGG + Intronic
960388128 3:117045562-117045584 CTGCATGGCAAGCTGCAGTCAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963335080 3:143965734-143965756 CTGGATATCAATCTACAGAAAGG + Intergenic
963496016 3:146062135-146062157 CTGCATTACAATCTGGTGACAGG - Intergenic
963894024 3:150666252-150666274 CTGGATGGCAAGCTCCTGACAGG - Intronic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966945446 3:184774170-184774192 CAGGAGGAAGATCTGCAGACCGG + Intergenic
968067501 3:195766835-195766857 CTGGTTGACCAGCTGCTGACCGG - Intronic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
969704262 4:8783522-8783544 TTGGATGTCACTCTGCAGCCCGG - Intergenic
973603048 4:52560787-52560809 CAGGTTGAGAATCTGCAGAGTGG - Intergenic
974289498 4:59912179-59912201 CTTGATGACATTATGCTGACTGG + Intergenic
974353369 4:60779307-60779329 CTGGATGAAAAACTTCATACTGG - Intergenic
975468794 4:74739884-74739906 CTTGGTGACAACTTGCAGACTGG + Intergenic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976588553 4:86826033-86826055 CTGTAAGCCAATCTGCAGAGAGG + Intronic
976775997 4:88706794-88706816 CTGGATGACAATCTGCAGACTGG - Exonic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978850372 4:113328732-113328754 CTGCATGACATGCTTCAGACAGG + Intronic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
983031409 4:162806722-162806744 CTGGATATCCATATGCAGACAGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991510852 5:67375171-67375193 CTGGCTGAGATTCTGCAAACAGG - Intergenic
993820934 5:92615700-92615722 CTGTATGACAATCAACACACAGG + Intergenic
994416776 5:99482184-99482206 CTGGATGACATTCTGCATTGAGG + Intergenic
994463194 5:100092973-100092995 CTGGATGACATTCTGCATTGAGG - Intergenic
997812641 5:136987076-136987098 CTGGATGACCATCTCCAGGGAGG + Intronic
998278958 5:140786513-140786535 CTGGAGGTAAATCTGCAGAATGG + Exonic
998279793 5:140795187-140795209 CTGGAGGTAAATCTGCAGAATGG + Exonic
998280374 5:140801420-140801442 CTGGAGGTAAATCTGCAGAATGG + Exonic
998280984 5:140807410-140807432 CTGGAGGTAAATCTGCAGAATGG + Exonic
998282137 5:140821995-140822017 CTGGAGGTAAATCTGCAGAATGG + Exonic
998282760 5:140828314-140828336 CTGGAGGTAAATCTGCAGAATGG + Exonic
998283354 5:140834606-140834628 CTGGAGGTAAATCTGCAGAATGG + Exonic
998284721 5:140848718-140848740 CTGGAGGTAAATCTGCAGAATGG + Exonic
998285452 5:140856268-140856290 CTGGAGGTAAATCTGCAGAATGG + Exonic
998285995 5:140861453-140861475 CTGGAGGTAAATCTGCAGAATGG + Intronic
998286665 5:140869326-140869348 CTGGAGGTAAATCTGCAGAATGG + Exonic
998287304 5:140875695-140875717 CTGGAGGTAAATCTGCAGAATGG + Exonic
998287964 5:140882491-140882513 CTGGAGGTAAATCTGCAGAATGG + Exonic
999005133 5:147967917-147967939 TTGTATGATAATCTGCAAACTGG + Intergenic
999420560 5:151438648-151438670 CTGCCTGACAACCTGCAGGCAGG - Intronic
1002802886 6:543000-543022 CTGGATGATAAGCTGGAGAGTGG + Intronic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1004552163 6:16658806-16658828 CTGGATGACAGTCAGCCGATGGG - Intronic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1007679036 6:43621774-43621796 CTGCAGGACAAACTGCGGACAGG - Exonic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1011259734 6:85458408-85458430 CTGGATGACCAGCTTCAGGCAGG + Intronic
1011997295 6:93608420-93608442 CTGGATGAGAATCTGGAAAGAGG + Intergenic
1012052248 6:94361191-94361213 CAGGATGACCAGCTGCAGACAGG - Intergenic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012751201 6:103166334-103166356 CTGAATGCCACTCTGCATACTGG + Intergenic
1012937677 6:105385064-105385086 CTGGATGACCATGAGCAGGCTGG + Intronic
1013086350 6:106861216-106861238 CAGGATGACTAGCTGCAGAGAGG - Intergenic
1013375554 6:109510298-109510320 CAGGATGACCAGCTGCAGAAAGG + Intronic
1016289821 6:142517080-142517102 CTTGATGACAATGTGCATAGGGG + Intergenic
1017563779 6:155662561-155662583 CTGCATGACTATGTGTAGACAGG - Intergenic
1017929726 6:158941350-158941372 CTGGAAGGCTATGTGCAGACTGG + Intergenic
1020041804 7:5009247-5009269 CTGGAGGACCATCTTCAGAGAGG - Intronic
1021899740 7:25272920-25272942 CTGGATGGATATGTGCAGACTGG + Intergenic
1022023713 7:26426315-26426337 CTGGATGACAAACTGAGGAAAGG - Intergenic
1023025511 7:36046257-36046279 TTGGATGATAATCTGGTGACTGG - Intergenic
1023348002 7:39291487-39291509 CTGGATCACAAGCTTTAGACCGG + Intronic
1027295205 7:76762995-76763017 TGGCATGACAATCTGTAGACTGG + Intergenic
1028037322 7:86001331-86001353 ATGAATGACAACCTGCAGAATGG + Intergenic
1028453460 7:91012539-91012561 CCTGAAGAAAATCTGCAGACAGG - Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1030538312 7:110796299-110796321 CTGGATGCCAAGCTTCAGAGAGG + Intronic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032156177 7:129470247-129470269 CTGGATAACAATCTGAGGATGGG - Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038698174 8:29824980-29825002 CAGGAAGACAATCTGTATACAGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1042196795 8:66238008-66238030 CAGGATGACCAGCTGCAGAAAGG - Intergenic
1043575471 8:81651495-81651517 CTAGATGGCAAACTGCACACAGG - Intergenic
1043577780 8:81677542-81677564 CTGCATGACAGTCTGAACACAGG + Intronic
1044286038 8:90413009-90413031 ATGGATGACATTATGCTGACTGG - Intergenic
1044354177 8:91201762-91201784 CTAGATGACAATTTTCAGAATGG - Intronic
1044361878 8:91295249-91295271 CTTTATGCCAATCTGCAGAGAGG + Intronic
1044953333 8:97454686-97454708 CTGGATGACAATTCCCAGAGAGG - Intergenic
1048718632 8:137297557-137297579 ATGGATCACAATCTGCAGTGTGG - Intergenic
1048973169 8:139656477-139656499 CTCCCTCACAATCTGCAGACAGG + Intronic
1049017567 8:139931648-139931670 CAGGATGTAGATCTGCAGACTGG - Exonic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1051764179 9:20503755-20503777 CTGAAAGACAACCTGCAGCCTGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1052707600 9:32011336-32011358 CGGGATGACCAGCTGCAGACAGG + Intergenic
1053833218 9:42106590-42106612 CTGGATAACACTGTGCAGTCGGG + Intronic
1054597333 9:67080819-67080841 CTGGATAACACTGTGCAGTCGGG - Intergenic
1056469320 9:86890013-86890035 CTGAATGATAATGTGGAGACAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1058546435 9:106065203-106065225 CTGGATTATAAGCTGCAGATGGG - Intergenic
1061709648 9:132478844-132478866 ATGAATGACAAGCTGCAGAGCGG - Intronic
1061777423 9:132974772-132974794 CTGGATGACAAGAAGGAGACAGG + Intronic
1062136659 9:134932472-134932494 GTGGAAGACAGTCTGAAGACGGG - Intergenic
1185926125 X:4148955-4148977 ATGAAAGACAATCTGCAGATTGG + Intergenic
1188461574 X:30432990-30433012 CAGGCTGAAAATCTGAAGACTGG + Intergenic
1190620653 X:52284354-52284376 CAGGATGACAAGCTGCAGAAAGG - Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1194625581 X:96222766-96222788 CTGGATGACTGTATGCAAACTGG - Intergenic
1195126531 X:101814008-101814030 CAGGATGACGAGCTGCAGAGAGG + Intergenic
1195269721 X:103217353-103217375 CTGGATGTGAAACTGCTGACAGG - Intergenic
1195454240 X:105050906-105050928 CTGGATGACCAGCTGCACAAAGG - Intronic
1196095227 X:111791561-111791583 TTGGATGAGACTCTGCAGGCAGG - Intronic
1201281777 Y:12348862-12348884 ATGGATGACTGTCTGAAGACAGG - Intergenic