ID: 976777412

View in Genome Browser
Species Human (GRCh38)
Location 4:88721500-88721522
Sequence CATTGCCGAGGCCAGCAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777412_976777426 22 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777426 4:88721545-88721567 ACGGGTTGATGAGGGAGTGGAGG No data
976777412_976777420 13 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777420 4:88721536-88721558 GTCCCCTGTACGGGTTGATGAGG No data
976777412_976777419 4 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777419 4:88721527-88721549 CTTCAGGTTGTCCCCTGTACGGG No data
976777412_976777427 30 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777412_976777425 19 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data
976777412_976777418 3 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777418 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
976777412_976777421 14 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777421 4:88721537-88721559 TCCCCTGTACGGGTTGATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777412 Original CRISPR CATTGCCGAGGCCAGCAATA GGG (reversed) Intergenic
No off target data available for this crispr