ID: 976777417

View in Genome Browser
Species Human (GRCh38)
Location 4:88721526-88721548
Sequence CCGTACAGGGGACAACCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777417_976777426 -4 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777426 4:88721545-88721567 ACGGGTTGATGAGGGAGTGGAGG No data
976777417_976777431 27 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data
976777417_976777425 -7 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data
976777417_976777427 4 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777417 Original CRISPR CCGTACAGGGGACAACCTGA AGG (reversed) Intergenic
No off target data available for this crispr