ID: 976777419

View in Genome Browser
Species Human (GRCh38)
Location 4:88721527-88721549
Sequence CTTCAGGTTGTCCCCTGTAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777412_976777419 4 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777419 4:88721527-88721549 CTTCAGGTTGTCCCCTGTACGGG No data
976777416_976777419 -8 Left 976777416 4:88721512-88721534 CCTCGGCAATGGCACCTTCAGGT No data
Right 976777419 4:88721527-88721549 CTTCAGGTTGTCCCCTGTACGGG No data
976777409_976777419 22 Left 976777409 4:88721482-88721504 CCTGAATGGGAAAGCTTGCCCTA No data
Right 976777419 4:88721527-88721549 CTTCAGGTTGTCCCCTGTACGGG No data
976777413_976777419 3 Left 976777413 4:88721501-88721523 CCTATTGCTGGCCTCGGCAATGG No data
Right 976777419 4:88721527-88721549 CTTCAGGTTGTCCCCTGTACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777419 Original CRISPR CTTCAGGTTGTCCCCTGTAC GGG Intergenic
No off target data available for this crispr