ID: 976777423

View in Genome Browser
Species Human (GRCh38)
Location 4:88721539-88721561
Sequence CTCCCTCATCAACCCGTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777423_976777427 -9 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777423_976777431 14 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data
976777423_976777434 21 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777423 Original CRISPR CTCCCTCATCAACCCGTACA GGG (reversed) Intergenic
No off target data available for this crispr