ID: 976777424

View in Genome Browser
Species Human (GRCh38)
Location 4:88721540-88721562
Sequence ACTCCCTCATCAACCCGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777424_976777427 -10 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777424_976777434 20 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data
976777424_976777431 13 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777424 Original CRISPR ACTCCCTCATCAACCCGTAC AGG (reversed) Intergenic
No off target data available for this crispr