ID: 976777425

View in Genome Browser
Species Human (GRCh38)
Location 4:88721542-88721564
Sequence TGTACGGGTTGATGAGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777417_976777425 -7 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data
976777412_976777425 19 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data
976777416_976777425 7 Left 976777416 4:88721512-88721534 CCTCGGCAATGGCACCTTCAGGT No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data
976777413_976777425 18 Left 976777413 4:88721501-88721523 CCTATTGCTGGCCTCGGCAATGG No data
Right 976777425 4:88721542-88721564 TGTACGGGTTGATGAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777425 Original CRISPR TGTACGGGTTGATGAGGGAG TGG Intergenic
No off target data available for this crispr