ID: 976777427

View in Genome Browser
Species Human (GRCh38)
Location 4:88721553-88721575
Sequence ATGAGGGAGTGGAGGACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777424_976777427 -10 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777417_976777427 4 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777412_976777427 30 Left 976777412 4:88721500-88721522 CCCTATTGCTGGCCTCGGCAATG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777413_976777427 29 Left 976777413 4:88721501-88721523 CCTATTGCTGGCCTCGGCAATGG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777422_976777427 -8 Left 976777422 4:88721538-88721560 CCCCTGTACGGGTTGATGAGGGA No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777423_976777427 -9 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data
976777416_976777427 18 Left 976777416 4:88721512-88721534 CCTCGGCAATGGCACCTTCAGGT No data
Right 976777427 4:88721553-88721575 ATGAGGGAGTGGAGGACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777427 Original CRISPR ATGAGGGAGTGGAGGACCCC AGG Intergenic
No off target data available for this crispr