ID: 976777431

View in Genome Browser
Species Human (GRCh38)
Location 4:88721576-88721598
Sequence TCCCTTCTTAATGTCAGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777422_976777431 15 Left 976777422 4:88721538-88721560 CCCCTGTACGGGTTGATGAGGGA No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data
976777424_976777431 13 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data
976777423_976777431 14 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data
976777417_976777431 27 Left 976777417 4:88721526-88721548 CCTTCAGGTTGTCCCCTGTACGG No data
Right 976777431 4:88721576-88721598 TCCCTTCTTAATGTCAGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777431 Original CRISPR TCCCTTCTTAATGTCAGCCT TGG Intergenic
No off target data available for this crispr