ID: 976777434

View in Genome Browser
Species Human (GRCh38)
Location 4:88721583-88721605
Sequence TTAATGTCAGCCTTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976777424_976777434 20 Left 976777424 4:88721540-88721562 CCTGTACGGGTTGATGAGGGAGT No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data
976777423_976777434 21 Left 976777423 4:88721539-88721561 CCCTGTACGGGTTGATGAGGGAG No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data
976777428_976777434 -9 Left 976777428 4:88721569-88721591 CCCCAGGTCCCTTCTTAATGTCA No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data
976777422_976777434 22 Left 976777422 4:88721538-88721560 CCCCTGTACGGGTTGATGAGGGA No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data
976777429_976777434 -10 Left 976777429 4:88721570-88721592 CCCAGGTCCCTTCTTAATGTCAG No data
Right 976777434 4:88721583-88721605 TTAATGTCAGCCTTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976777434 Original CRISPR TTAATGTCAGCCTTGGCCAC AGG Intergenic
No off target data available for this crispr