ID: 976783239

View in Genome Browser
Species Human (GRCh38)
Location 4:88785795-88785817
Sequence CAGTGTGGGCTGGGAGTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976783233_976783239 1 Left 976783233 4:88785771-88785793 CCTGGAGAGCTAAGAGAAGCCGT 0: 1
1: 0
2: 0
3: 13
4: 122
Right 976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG 0: 1
1: 0
2: 5
3: 43
4: 447
976783232_976783239 8 Left 976783232 4:88785764-88785786 CCAAAGACCTGGAGAGCTAAGAG 0: 1
1: 0
2: 1
3: 12
4: 204
Right 976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG 0: 1
1: 0
2: 5
3: 43
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976783239 Original CRISPR CAGTGTGGGCTGGGAGTTGA AGG Intronic
900033394 1:387406-387428 CACTCTGAGCTGGGAGTTAAAGG + Intergenic
900054232 1:617295-617317 CACTCTGAGCTGGGAGTTAAAGG + Intergenic
900480554 1:2896072-2896094 CAGGGCAGGCTGGGAGCTGAGGG + Intergenic
900694137 1:3999752-3999774 CAGGGTGGGCATGGAGTTGCAGG + Intergenic
901421440 1:9154007-9154029 CAGTCTTGGCTGGGAGTTGAGGG - Intergenic
901657729 1:10779985-10780007 CAGGGTGGGCGGGGTGTTGGTGG - Intronic
902057269 1:13611750-13611772 CAGTGTTGGCGGGGAGTGGGGGG + Intronic
902335707 1:15753498-15753520 CTGTGAAGGCTGGGAGTTGCTGG - Intergenic
902769538 1:18637680-18637702 CTGTGGGGGCTGGGCGTAGATGG - Intronic
902781534 1:18708189-18708211 GAGAGTGGGCTGGGGGTTGCGGG - Intronic
902891528 1:19447764-19447786 CAGTGTGGCCTGCGAGCTGCTGG - Intronic
903173195 1:21566078-21566100 CAGGGTGGGCTGGGAGAAGAAGG - Intronic
903650321 1:24918006-24918028 AAGTGCTGGCTGGGAGCTGACGG + Intronic
903704853 1:25278314-25278336 CATTCTGGGCTTGGAGTTAAGGG + Intronic
903722378 1:25415007-25415029 CATTCTGGGCTTGGAGTTAAGGG - Intronic
904038459 1:27571108-27571130 CAGTGTGGGCTGCCAGGTGGAGG + Intronic
904043208 1:27595912-27595934 GTGTGTGGGCTGGGTGTTGTAGG + Intronic
904239826 1:29136716-29136738 CAGTGTGGGAGTGGAGTTCACGG + Intergenic
904530347 1:31164544-31164566 CAGCTTGGGCTGGGGGTGGAGGG - Intergenic
904561079 1:31397675-31397697 CAGTGAGGCCAGGAAGTTGAGGG - Intergenic
904592300 1:31621628-31621650 CTGTGTGGGCTGGGGGTGGGAGG + Intronic
904925090 1:34041315-34041337 CAGTGTGGACTGAGACCTGAGGG + Intronic
905317675 1:37093933-37093955 CAGTCTGGGCTGGGAGGTTTTGG - Intergenic
905325399 1:37148228-37148250 CACTGTGGGCCAGGAGTTGCAGG + Intergenic
905822727 1:41006373-41006395 TACTGTGTTCTGGGAGTTGAGGG - Intronic
906060884 1:42947954-42947976 CCCTGTGGGCTTGGAGTGGAGGG - Intronic
906372018 1:45262127-45262149 CAATGTGGGGTGGGAGTTGGTGG + Intronic
906488555 1:46249596-46249618 CTCAGTGGCCTGGGAGTTGAAGG + Intronic
907351197 1:53832769-53832791 CAGTGTGGGCTGGGCATGGGGGG + Intronic
907470529 1:54670796-54670818 CAGGGTGGGCTGGGTGTGGCTGG - Exonic
907742564 1:57181291-57181313 CAGTGAGGCCTCGGACTTGACGG + Intronic
908452511 1:64269760-64269782 TGGTGTTGGCTGGGAGATGAAGG + Intergenic
910248058 1:85163761-85163783 CAGTGTGGGGTGAGAGTAGCAGG + Intronic
911026468 1:93440728-93440750 CAGTGAGGCCTGGGCGTTGTTGG + Intergenic
911105626 1:94129103-94129125 GAGTGGAGGCTGAGAGTTGAGGG + Intergenic
911224433 1:95289599-95289621 CGGTGTGAGATGGGAGTTGAAGG - Intergenic
912378324 1:109230987-109231009 CCGTGGTGGCTGGGAGTCGAGGG + Exonic
912791853 1:112660160-112660182 CAGCCTGGGCTGGGAGGTGGAGG - Intronic
913559399 1:120002293-120002315 CAGTGTTGGCTGGGACATCAAGG + Intronic
913638463 1:120788249-120788271 CAGTGTTGGCTGGGACATCAAGG - Intergenic
914279993 1:146161736-146161758 CAGTGTTGGCTGGGACATCAAGG + Intronic
914541033 1:148612654-148612676 CAGTGTTGGCTGGGACATCAAGG + Intronic
914625609 1:149458592-149458614 CAGTGTTGGCTGGGACATCAAGG - Intergenic
915142567 1:153776428-153776450 CAGTGTGGGCTGGGATAGGGAGG + Intronic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915708712 1:157872482-157872504 TTGTGTGGGCTGGGAGTTAGAGG - Intronic
915744920 1:158148533-158148555 CAGGGAGGGCTGGGAAGTGAGGG - Intergenic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916166544 1:161971229-161971251 CAGTGTGCCCTGGGAGTGGGCGG + Intergenic
916735186 1:167601365-167601387 CTGGCTGGGCTGGGAGTTGAGGG + Intergenic
916942594 1:169691576-169691598 ACCTGTGGGCTGGGGGTTGAGGG + Exonic
917711312 1:177688164-177688186 CAGTGTGGGCTTTGAGTTGGGGG + Intergenic
919817064 1:201448310-201448332 CTGTGTGTGCTGGGAGCTGCCGG - Intergenic
919955396 1:202409604-202409626 AAGTGTTGGCTGGGCGTTGTGGG - Intronic
920821658 1:209387292-209387314 CAGTGGGGGTGGGGAGTTGGGGG - Intergenic
921671356 1:217927310-217927332 CAGTGTGTCCTGGGAGTGGTAGG + Intergenic
921916947 1:220623920-220623942 AAGTGTGGGCTGGGATTTTCAGG - Intronic
922248247 1:223821511-223821533 AGGTGTGGACTGGGGGTTGAGGG + Intronic
922255750 1:223891560-223891582 CACTCTGAGCTGGGAGTTAAAGG + Intergenic
923011010 1:230087468-230087490 CAGTGCGGGCTGGCAGTTATGGG - Intronic
923664977 1:235991758-235991780 CCCTGTGGGCAGGGAGTTCAGGG - Intronic
923851231 1:237797430-237797452 CATTGTGGCCAGAGAGTTGAAGG + Intronic
924336949 1:242994425-242994447 CACTCTGAGCTGGGAGTTAAAGG + Intergenic
1063040492 10:2332643-2332665 CAGTGGGAGGTGGGAGCTGAGGG - Intergenic
1063822832 10:9856772-9856794 CAGGGTGGCCTTGGAGTAGAAGG - Intergenic
1064231863 10:13536369-13536391 CAGTGTAGCATGGGAGTTTATGG + Intergenic
1064288380 10:14012144-14012166 GGATGTGGGGTGGGAGTTGAGGG + Intronic
1064715416 10:18171885-18171907 CATAGTGGGGTGGGAGGTGAGGG - Intronic
1066070210 10:31800957-31800979 CAGTGGGGACTTGGAGTTAATGG - Intergenic
1066693723 10:38059685-38059707 CAGTGGTTGCTGAGAGTTGAGGG + Exonic
1066999093 10:42589459-42589481 CAGTGGTTGCTGAGAGTTGAGGG - Exonic
1067044934 10:42980226-42980248 CTGTGTGGGAGGGGAGGTGAGGG - Intergenic
1069628287 10:69881411-69881433 CAGTGAGGGGTGGGAGCAGAGGG + Intronic
1069889319 10:71643488-71643510 CAGTGTAGGCTGGGATGGGAGGG - Intronic
1070150090 10:73800160-73800182 CAGTGTGGCCTGTGAGTTGTGGG + Exonic
1070649593 10:78225310-78225332 AAGTGGGGGAGGGGAGTTGATGG + Intergenic
1071050560 10:81443417-81443439 TAGTGTGGGCTGGAGGTTGGAGG - Intergenic
1071416905 10:85449931-85449953 CAGAGTGGACTGGGACTTCAGGG + Intergenic
1072591258 10:96830967-96830989 CGGGGTGGGCTGGGAGTGGTGGG + Intergenic
1073047132 10:100646146-100646168 GGGGGTGGGCTGGGAGTTGGTGG + Intergenic
1073250267 10:102117000-102117022 CAGGGTGGGCTGGGGGGTGGGGG + Intronic
1073301398 10:102473180-102473202 CAGGGTGTGGTGGGTGTTGAGGG + Intronic
1074046824 10:109847077-109847099 AAGTCTGGGCTGGGAGTCGGGGG + Intergenic
1075641050 10:124064825-124064847 CAGTGTGGTCTGGGGTTTCAGGG - Intronic
1075894950 10:125986958-125986980 CAGTGGGGGCTGGGAGTGAGTGG + Intronic
1075991624 10:126843220-126843242 CAGGGAGGGCTGGGAGCTGAGGG + Intergenic
1076235744 10:128862673-128862695 CCGTGTGGGTTGGGAGCTGGAGG + Intergenic
1076795378 10:132795542-132795564 CAGGGAGGGGTGGGAGCTGACGG + Intergenic
1077350642 11:2091619-2091641 GAGTGTGGGGTGGGAGCAGAGGG - Intergenic
1077407006 11:2387142-2387164 CAGGGAGGGCTGGGGGTGGATGG + Intronic
1077426597 11:2482643-2482665 CAGTGTGGGGTGGGGGTTGGCGG - Intronic
1077469672 11:2751295-2751317 AAGTGGGGGGTGGGAGATGAGGG - Intronic
1078328291 11:10398100-10398122 CAGTGTGGATTTGGAGTGGAAGG + Intronic
1079441029 11:20515168-20515190 CAGTGTGGGCAGTGAGTTAGGGG - Intergenic
1080534248 11:33206178-33206200 AAGGATGGGCTGGGAGTGGAGGG - Intergenic
1082998137 11:59268759-59268781 CAGTGGGTGCTGGGTGATGAAGG + Intergenic
1083088986 11:60180390-60180412 CAGTGGAGTCTGGGAGATGAGGG - Intronic
1083628631 11:64084770-64084792 CAGTCTGGGCTGGCGGGTGAGGG - Intronic
1083851619 11:65371000-65371022 CGGCCTGGGCTGGGAGCTGAGGG + Intergenic
1084302087 11:68258588-68258610 CAGAGTGGGCAGGCAGTTGGTGG + Intergenic
1084597641 11:70126572-70126594 CAGTGTAGGCTGGTACTTGCGGG + Intronic
1084641929 11:70431372-70431394 CAGTGTGGCGTGGGTGTAGAGGG + Intronic
1084705808 11:70815463-70815485 GAGTGTCCGCTGGGAGGTGAGGG - Intronic
1085031344 11:73272682-73272704 CAGTGGGGGCGGGGAGGAGATGG + Intronic
1085065097 11:73488016-73488038 CAGTGTTGGCAGAGAGTAGACGG - Intronic
1085286341 11:75364101-75364123 CAGAGTGGGCAGGGATATGATGG - Intergenic
1085464952 11:76716913-76716935 CAGAGAGGGCTGGGATTGGAAGG + Intergenic
1088313468 11:108484350-108484372 CATTGTGGGCTGGTGGTGGAGGG + Intronic
1089256818 11:117198578-117198600 TAGTTGGGGCTGGGATTTGAGGG - Intergenic
1090347741 11:126084522-126084544 CAGTGCGGGCTGGGGGTGGGGGG + Intergenic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1091896350 12:4108321-4108343 CATTGTGGGATGGGAGTTGAAGG - Intergenic
1092046640 12:5435582-5435604 GGGTGTGGGCTGGGAATTGGAGG + Intronic
1092126757 12:6080036-6080058 AAGTGTGGGGTGGGAGTTAGTGG - Intronic
1093778019 12:23099906-23099928 CAGTGTGGTATGGGAATGGAGGG + Intergenic
1095487948 12:42703820-42703842 CAGTGAGGGCTGAGAGGTAATGG + Intergenic
1095560000 12:43552670-43552692 CTGTGTGTGCTGGGAGTTGCCGG + Intergenic
1095716474 12:45351564-45351586 CAGAGTGGGAAGTGAGTTGAGGG + Intronic
1095947831 12:47763815-47763837 CAGTCAGGGCTGGGAGCTGCAGG + Intronic
1097282496 12:57853282-57853304 CAGTCTGGGCTGGGGGTACAGGG - Intergenic
1097475234 12:60047021-60047043 AAGTGTGGGGTAGGAGATGATGG - Intergenic
1099097866 12:78398130-78398152 GACTGTGGGCTGAGAGATGATGG - Intergenic
1100863481 12:98831491-98831513 GGGTGTGGGATGGGAGGTGAGGG + Intronic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102145085 12:110649203-110649225 CAGTGTGGGGTGGGAGTGGATGG + Exonic
1102648364 12:114418565-114418587 CAAGGGGGGCTGGGAGTAGAGGG - Intergenic
1104854151 12:131894460-131894482 CCGGGTGGGCTGGGAGTGGGTGG - Intergenic
1105504833 13:21000624-21000646 AAGTGTGGGATGGGAGTTAGAGG + Intronic
1105734189 13:23250873-23250895 CAGAGTGGGGTGGGGGGTGAGGG + Intronic
1108225672 13:48286501-48286523 CAGTGTGGCCTGGAAGCAGATGG + Intergenic
1108334841 13:49429177-49429199 CACTCTAGTCTGGGAGTTGAAGG - Intronic
1108624991 13:52218968-52218990 AAGTGTGTGTTGGGAGTTGGGGG + Intergenic
1108661061 13:52587449-52587471 AAGTGTGTGTTGGGAGTTGGGGG - Intergenic
1111231776 13:85353864-85353886 CTGTGGGGGCTGGGAGTGCAGGG - Intergenic
1113422702 13:110182647-110182669 CAGGGTGGGTTGGGAGTTGGGGG - Intronic
1115728239 14:36240040-36240062 CATTGTGGGGAGTGAGTTGAGGG + Intergenic
1117438689 14:55741132-55741154 CAGTGTGCCCTGGGAGATGGGGG + Intergenic
1118450907 14:65901407-65901429 CAGGTTGAGCTGGCAGTTGATGG + Intergenic
1120156400 14:81098135-81098157 CAGTGTGGGCAGGGAGCACATGG - Intronic
1120702901 14:87717496-87717518 CAGAGTGAACTGGGAGGTGAGGG - Intergenic
1121392651 14:93589422-93589444 CAGTATGGGCTGGGGGATGGGGG + Intronic
1121760035 14:96436889-96436911 CAGTGTGGCCTGGGACTGGTTGG + Intronic
1122943933 14:104996460-104996482 GAGTGGGGGCAGGGAGCTGACGG + Intronic
1123756746 15:23402847-23402869 CAGTGTGGACTGGAAGATGGCGG - Intergenic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1125015352 15:34928343-34928365 CTGTCGGGGATGGGAGTTGAGGG - Intronic
1125179274 15:36862818-36862840 CACTGGGGGCTGGGAATGGAAGG + Intergenic
1125517223 15:40328585-40328607 CAGTGGGTGCTGGGTGCTGATGG + Intergenic
1125672586 15:41484807-41484829 AAATTTGAGCTGGGAGTTGATGG - Intergenic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1125798801 15:42425948-42425970 CAGGGTTGGCTGGGGGATGAAGG - Intronic
1127046265 15:55028879-55028901 CAGTGTGGGCTGTGAGTGAGGGG + Intergenic
1127262373 15:57335701-57335723 CAGTCTGAGCTGGGATTTGGGGG - Intergenic
1128313284 15:66644885-66644907 CAGCGTGGGATGGGACTGGAAGG - Intronic
1129167543 15:73787293-73787315 CAGGGGGGCCTGGGAGGTGAGGG + Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129235502 15:74221590-74221612 CTGTGTGGGTGGGGAGGTGATGG + Intergenic
1129250515 15:74306318-74306340 CTGCCTGGGGTGGGAGTTGATGG - Intronic
1129271310 15:74420727-74420749 CAGTTTGGGCTGCGGGTGGAAGG - Intronic
1129666043 15:77579919-77579941 CAGTGTGAGCTGGGGGTGGGGGG - Intergenic
1129709623 15:77813934-77813956 CAGGGTTGCCTGGGAGGTGAAGG + Intronic
1129767367 15:78178869-78178891 CAGTGGGGGCTTGGAGGAGACGG - Intronic
1129898062 15:79123096-79123118 CAGTCTGGGCTGGGCCTCGAGGG + Intergenic
1130709449 15:86265337-86265359 CAGAGCTGGCGGGGAGTTGATGG + Intronic
1131053612 15:89363041-89363063 CAGGGTCGGCTGGAAGTTGTGGG + Intergenic
1131113713 15:89781053-89781075 CACTGAGGGTTGGGAGTTGGGGG + Intergenic
1131174396 15:90201123-90201145 CAGTGGGGGCGGGGAGCTGGGGG + Intronic
1132957319 16:2601810-2601832 CACTGTGGGCAGGGAGTTGGGGG - Exonic
1132969658 16:2680226-2680248 CACTGTGGGCAGGGAGATGGGGG - Intergenic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1134024453 16:10943221-10943243 CAGTGTGGCCTGAGATTTAAAGG - Intergenic
1135510814 16:23081497-23081519 CAGGGTGGGCTGCTAGTAGATGG - Intronic
1135584759 16:23661322-23661344 AAGTGAGGGATGGGAGCTGAAGG - Intronic
1135974203 16:27096575-27096597 CAGTGGGGGATGGGAGTTGGTGG - Intergenic
1136710886 16:32235317-32235339 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136757024 16:32694094-32694116 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1136811085 16:33176281-33176303 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136817561 16:33286361-33286383 GAGTGTGGGCTGGATGTGGAAGG + Intronic
1136824125 16:33342890-33342912 GAGTGTGGGCTGGATGTGGAAGG + Intergenic
1136999270 16:35215189-35215211 GAGTGTGGCCTGGAAGTGGAAGG - Intergenic
1137944353 16:52719444-52719466 CACTGTAGGCTGGAAGTTCAAGG - Intergenic
1138115479 16:54357462-54357484 CAGAGAGGGCTGGGAGATGGTGG + Intergenic
1139097456 16:63722024-63722046 TGTTGTGGGGTGGGAGTTGAGGG - Intergenic
1139115529 16:63947047-63947069 CAGTGTGGGGTGGAAGATGATGG + Intergenic
1139341933 16:66273107-66273129 CAATGAGGGCTGGGAGCTGGTGG - Intergenic
1141209433 16:81963092-81963114 CACTGGGGGCTGGGGGTTGGGGG - Intergenic
1141622110 16:85241871-85241893 CAGTGTGGGCTGGGGGTGCCCGG - Intergenic
1142076552 16:88121162-88121184 CATTGTGGGGTGGGGGTTGGGGG + Intergenic
1142230818 16:88899502-88899524 CAAGGCGGGCTGGGAGTGGAGGG + Intronic
1142390766 16:89798248-89798270 CAGTGGAGGCTGGAAGTTGGAGG - Intronic
1203059173 16_KI270728v1_random:954445-954467 GAGTGTGGGCTGGATGTGGAAGG - Intergenic
1142992169 17:3738830-3738852 CGGTGTGGGCTGGGCCATGACGG - Intronic
1143174249 17:4947545-4947567 CAGTGTGGACAGGGAGATGGTGG + Intronic
1144193257 17:12866037-12866059 AAGAGTGGGGTGGGAGTTGGGGG + Intronic
1144877633 17:18410791-18410813 CAGTGTGGGAGAAGAGTTGAGGG - Intergenic
1145154597 17:20533612-20533634 CAGTGTGGGAGAAGAGTTGAGGG + Intergenic
1146623880 17:34421330-34421352 GGGTGTGGGCTGGGGGTTGTTGG - Intergenic
1147680083 17:42237564-42237586 TAGTGTGGGGTGGGAGTAGGGGG + Intronic
1148534584 17:48429344-48429366 CAGTGTGTGTTGAGTGTTGACGG + Intronic
1148862100 17:50609785-50609807 CAGAGTGAGGTGGGAGCTGAGGG + Intronic
1149989199 17:61371422-61371444 CAGAGTGGTCTGGGGGTTGAAGG + Intronic
1150284426 17:63947093-63947115 CAGTGTCCGCAGGGATTTGATGG + Exonic
1150598976 17:66633609-66633631 CATTGAGGGCTGGGGGTTCAGGG - Intronic
1151635398 17:75344218-75344240 CTGTGTGGACTGTGAGTAGAAGG + Intronic
1151668453 17:75558649-75558671 CAGGCTGGGCTGGGAGTGGAAGG - Intronic
1151936732 17:77266518-77266540 CACTGTGGGATGGGGGTGGAGGG - Intergenic
1152178662 17:78803912-78803934 CAATGTGGGGTGGGGGCTGAAGG + Exonic
1152193682 17:78903653-78903675 CTGTGTGGGCAGGTGGTTGACGG - Intronic
1152668461 17:81586216-81586238 AAGTGAGTGCTGGGAGATGAGGG + Intronic
1152677391 17:81648549-81648571 GAGTGGGGGCTCGGAGGTGAGGG - Exonic
1153337514 18:3939678-3939700 TAGTGGAGGCTGGGAGTGGAGGG + Intronic
1153643074 18:7172335-7172357 CAGTGGGGGCTGGGAGTGAGGGG - Intergenic
1153806461 18:8712435-8712457 CAGTGTGGCCTGGGGGTGGAGGG + Intronic
1154349663 18:13572410-13572432 CAGCCTGGGCTGGGAGTGGAAGG + Intronic
1155138408 18:23019567-23019589 CAGTGAGGTTTGGGAATTGAGGG - Intronic
1155373797 18:25134518-25134540 CAGTTTGGGCAGGTAGTAGAAGG - Intronic
1155906817 18:31462154-31462176 CACTGGGGCCTGGGAGGTGAAGG - Intronic
1156469171 18:37366844-37366866 GAGGGTGGGATGGGAGTGGAGGG - Intronic
1157395774 18:47339737-47339759 CAATGTGTGCTGGGAGATGTGGG + Intergenic
1157605528 18:48923684-48923706 TAGTGGGGGTTGGGGGTTGAGGG - Intronic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1159713273 18:71790636-71790658 TAGTGTGGGGTGGGAGTGGGAGG - Intergenic
1160334546 18:78027045-78027067 CAGTGGGGGATGGAAGTTGCAGG + Intergenic
1160507932 18:79437621-79437643 CAGTGTGAGCTGGGATTTGGGGG - Intronic
1160528324 18:79549812-79549834 CAGTGGGGCCTGGGATGTGAAGG - Intergenic
1160907982 19:1460702-1460724 CAGACGGGGCTGGGAGGTGAGGG + Intronic
1160914004 19:1488119-1488141 CTGTGAGGGCCTGGAGTTGAGGG + Intronic
1161328779 19:3676347-3676369 CAGGGTGTGCTGGGAGTGGTGGG - Intronic
1161567109 19:5009412-5009434 CAGTGGGGCCTGGAAGTGGAAGG + Intronic
1161766979 19:6213559-6213581 CGGTGTGGCCTTGGAGCTGAGGG - Intronic
1161960070 19:7518231-7518253 CAGCCAGGGCAGGGAGTTGAGGG - Intronic
1162308122 19:9888045-9888067 AAGTGAGGGCAGGGAGGTGATGG - Intronic
1162336429 19:10063506-10063528 CAGTGAGGGCTGGGAGGCCATGG + Intergenic
1162394512 19:10409078-10409100 CAGGCTGGGCTGGTAGCTGACGG + Intronic
1163446735 19:17351503-17351525 CAGGCAGGGCTGGGAGTTGGGGG + Exonic
1165067780 19:33239141-33239163 CAGTGTGTGCTGGGAAGGGAAGG - Intergenic
1165455357 19:35907606-35907628 CAGTGTGTGCTGGGAACTGTGGG + Intronic
1165700380 19:37932847-37932869 AAGAGTGGGCCGGGTGTTGACGG + Intronic
1165941686 19:39417700-39417722 CAGGGTGGGCTGGGGCTTGCTGG + Intronic
1166071369 19:40390064-40390086 CAGTGTGGCCTGGGGGTTTGGGG - Exonic
1166233664 19:41440858-41440880 CATTCTGGGCTGGGAGAGGATGG + Intergenic
1166322664 19:42028323-42028345 CAGGATGGGTTGGGAGCTGAGGG - Intronic
1166584985 19:43937756-43937778 CAGAGGGGGTTGGGAGTGGAGGG - Intergenic
1166760950 19:45224282-45224304 CTGCGTGAGCTGGGAGTTGTGGG + Intronic
1166773434 19:45298117-45298139 CAGTGTGAGGAGGGAGGTGAGGG - Intronic
1167096298 19:47376616-47376638 CAGAGGGGCCTGGGAGTTCACGG - Intronic
1167263010 19:48469543-48469565 CGGGGTCGGCTGGGAGTTGCTGG + Intronic
1168185826 19:54698696-54698718 CAGGGAGGGCTGGGAGGAGACGG + Intronic
1168421937 19:56210171-56210193 CTGTGTGGGGTGGGAGTCTACGG - Intergenic
1168507573 19:56949549-56949571 CAGTATGGGTTGGGGGTTGGGGG - Intergenic
924989974 2:305817-305839 CTGTGTGTGGTGGAAGTTGAGGG - Intergenic
925173718 2:1767933-1767955 AAGTGTGGGGTGGGGGTAGAGGG + Intergenic
928140487 2:28724188-28724210 CAGTGGGGGCTGGGAGGGCAGGG + Intergenic
928253025 2:29698439-29698461 CAATGTGGGATGGGAGTGGCTGG - Intronic
929226757 2:39519076-39519098 CAGTGTGGAATAGGAGGTGAAGG + Intergenic
929379468 2:41333433-41333455 GAGTGAGGCTTGGGAGTTGATGG - Intergenic
929488837 2:42378677-42378699 CAGTGTGGCCTTGAAGGTGAAGG - Intronic
929914317 2:46121488-46121510 CAGACTGGGCAGGGAGTTGCAGG - Intronic
929952098 2:46419955-46419977 AAATGGGGGGTGGGAGTTGAGGG + Intergenic
930086094 2:47498300-47498322 CAGTGTGGTCTTGCAGTTGTGGG - Intronic
931455607 2:62407713-62407735 CGGTGGGGGCTGGAACTTGATGG - Intergenic
936108798 2:109648175-109648197 TGGCGTGGGCTGGGAGCTGAAGG + Intergenic
936410524 2:112254512-112254534 CAGTGTCCTCTGGGAGTTTACGG + Intronic
936745948 2:115576765-115576787 AAGTGTGGGCCTGGAGTTGGAGG - Intronic
936911522 2:117598563-117598585 CAGTGAGGGAAGGGATTTGAAGG - Intergenic
937100114 2:119262024-119262046 CAGTGTGGGGTGGGAGGTGAAGG + Intronic
937232047 2:120403922-120403944 TTGTGGGGGCTGGGAGATGATGG + Intergenic
937490605 2:122363255-122363277 AACTGTGGGCTGGGAGTCTAAGG + Intergenic
938314406 2:130316021-130316043 CAGGGTGTGCTTGGAGCTGAGGG + Intergenic
939858509 2:147390005-147390027 CTGTGGGGGCTGGGGGTTGGGGG - Intergenic
940875880 2:158896574-158896596 CAGTCTGGGCTGGGAGCAGCAGG - Intergenic
941708232 2:168682679-168682701 CAATGGGGGGTGGGAGTTGGTGG + Intronic
942244547 2:173995031-173995053 CAGTGGGGGCTAGAAGTGGAGGG + Intergenic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
944908501 2:204286311-204286333 TAGTGGAGGCTGGGAGTTGCTGG + Intergenic
944924685 2:204452511-204452533 GGGTGTGGGATGGGAGTTTAAGG - Intergenic
945694575 2:213086775-213086797 TAGTGTGGAATGGGAGTGGAGGG + Intronic
946360405 2:219216204-219216226 CAGTAGGGCCTGGGAGCTGAGGG + Intronic
946386171 2:219385805-219385827 GGGAGTGGGCTGGGAATTGAAGG - Intronic
947344767 2:229179287-229179309 CTGGGTGGGCTGGGGGCTGATGG - Intronic
947541553 2:230983463-230983485 CTGTGGGGGATGGGAGTTGGGGG - Intergenic
948330485 2:237160652-237160674 GAGTGTGGGCTGGAAGGAGATGG + Intergenic
948427304 2:237896025-237896047 CATTGTGGGCCGGGTGCTGAGGG - Intronic
948629671 2:239294048-239294070 GAGGGTGGGCTGGGAGACGATGG - Intronic
948742115 2:240054969-240054991 CAGGGTGGGCTGGGGGGTGGTGG + Intergenic
948839876 2:240643617-240643639 CAGAGAGGGCTGGGGGCTGAGGG - Intergenic
1168810874 20:703788-703810 CAGTGTGAACAGGAAGTTGACGG + Intergenic
1169206964 20:3745953-3745975 CACTGTGCGCTGGGTGTTGACGG + Exonic
1169245102 20:4018852-4018874 CAGTGGGGGCTGGGAGTGGTGGG - Intergenic
1169249638 20:4050462-4050484 TAGAGTGGGCTGGGAGCTGTTGG - Intergenic
1170168090 20:13382138-13382160 CAGTATGAGCTGGAAGTTGGGGG + Intergenic
1171432018 20:25088973-25088995 CCATTTGGGCTGGGCGTTGATGG - Intergenic
1171986407 20:31664531-31664553 AAGTGTGGGGTGGGGGTTGGGGG + Exonic
1172304360 20:33870905-33870927 CTGCGTGGGGTGCGAGTTGAGGG + Intergenic
1172993557 20:39053300-39053322 TCGTTTGGACTGGGAGTTGAGGG + Intergenic
1173017359 20:39237671-39237693 CAATGAGGGATGGGAGTTGGTGG + Intergenic
1173396617 20:42686311-42686333 CAGTGAGGGATGGAAGTTGGTGG + Intronic
1173464919 20:43273107-43273129 CACTGTGGGCTGGGAGTCAAAGG - Intergenic
1174485955 20:50861395-50861417 CAGTGTGGGCCTGGGGTGGAGGG + Intronic
1174611254 20:51800717-51800739 CGGGGTGGGGTGGGGGTTGAGGG - Intronic
1175644513 20:60659335-60659357 CAATGTTGGCTGTGACTTGATGG - Intergenic
1175978913 20:62727348-62727370 CACTCTGGGCTGGGACTTGCTGG - Intronic
1176741322 21:10606074-10606096 GAGTGTGTGTTGGGAGTTGGGGG - Intronic
1177803795 21:25854562-25854584 CACTGTGGGCTGGGAGTAGTGGG + Intergenic
1178433023 21:32532889-32532911 CAGTGAGGGCTGGAATTTGAAGG - Intergenic
1179727156 21:43347053-43347075 CACTGTGGTCTGGGAGCTGCCGG - Intergenic
1181054894 22:20256256-20256278 CAGTGTGGCCTTGGACTTGAGGG - Intronic
1181077111 22:20387334-20387356 CTGAGTGGGCTGGGAGCTGGCGG + Intronic
1181407116 22:22692921-22692943 CACTGTGGGCTGGGGGCTCAGGG - Intergenic
1181415107 22:22753695-22753717 CACTGTCGGCTGGGAGCTCAGGG - Intronic
1181521252 22:23449927-23449949 CAGAGAGGGGTGGGAGCTGAGGG + Intergenic
1182176971 22:28300270-28300292 CAGTTTGGGCTGTCAGTTTAGGG - Intronic
1182932926 22:34192083-34192105 AAGTGTGGGCTGGGTGGTCAGGG + Intergenic
1183280517 22:36929658-36929680 CAGGGTGGCCTGGGAGGTGTTGG - Exonic
1183506211 22:38210333-38210355 CTGTGTGGGCTGGGAGGAGCTGG + Intronic
1183545461 22:38452874-38452896 CAGTGTGGGGTGGGGGTGGCGGG - Intronic
1183589046 22:38769391-38769413 GAGCGTGGGCTGGGGGCTGAGGG + Intronic
1183952803 22:41361204-41361226 CAGTTTAGCCTGGGAGGTGAAGG - Intergenic
1184365211 22:44046789-44046811 CAGTGTGGGGTGGCAGGAGATGG + Intronic
949605578 3:5649633-5649655 TAGTGGTTGCTGGGAGTTGAGGG + Intergenic
949903691 3:8840619-8840641 CAGCGTGGGACAGGAGTTGAGGG - Intronic
950682407 3:14594274-14594296 CAGTCTGTGCTGGGAGCTAAGGG + Intergenic
950766026 3:15273730-15273752 TAGTGAGGGCTGGGAAGTGAGGG - Intronic
950880171 3:16316967-16316989 CTGTGTGGGGTGGGTGTGGAGGG - Exonic
950936158 3:16841640-16841662 CAGTGGGGGCTGGAAGGTGGAGG + Intronic
951745376 3:25972090-25972112 CAGTGGGTGATGGGATTTGAGGG + Intergenic
952282710 3:31938916-31938938 GAGGGTGGGCAGGAAGTTGAAGG - Intronic
953502246 3:43448360-43448382 CAGTGGCAGCTGGGAGTTGAGGG - Intronic
954025577 3:47781053-47781075 CTGTGTGGCGTGAGAGTTGATGG - Intronic
954098142 3:48347529-48347551 CACTGGGGCATGGGAGTTGATGG - Intergenic
954150148 3:48653224-48653246 CCATGTGGGCTGGGACTTGGAGG + Intronic
954224661 3:49174070-49174092 CAGTGGGGGCTGGGAGATCTGGG - Intronic
954435643 3:50494457-50494479 CAGTGTGGGCTTGGAGGGGCTGG - Intronic
954633642 3:52059849-52059871 CAGTGTGGTGTGGTAGTGGATGG - Intergenic
955214057 3:56970407-56970429 TAATGTGGCCTGGGATTTGATGG + Intronic
956718463 3:72098534-72098556 CTGTGGGGCCTGGGAGCTGATGG + Intergenic
956827149 3:73008020-73008042 GGGTGGGGGCTGGGGGTTGAGGG - Intronic
959023611 3:101215550-101215572 TAGTGGGAGCTGGGAGGTGAAGG - Intergenic
959100756 3:102007341-102007363 CAGTGTGGACTGAAAGCTGAGGG - Intergenic
959421434 3:106134692-106134714 CACTGTGGAGTGGTAGTTGAGGG + Intergenic
959862015 3:111227114-111227136 CAGTATTGGCTGGGAGCTGGGGG + Intronic
961047590 3:123720227-123720249 CTGTGGGGGCTGGGACCTGAAGG - Intronic
961382000 3:126501193-126501215 GAGTGGGGGTTGGGAGTTGATGG - Intronic
963051421 3:141147071-141147093 CAGTGGGGGCTGGGATGAGAAGG + Intronic
964942561 3:162177123-162177145 CTGTCTGGGCTGGGGGTTGGGGG + Intergenic
965811139 3:172592650-172592672 CAGTGAGGACTGGGACTTGTGGG + Intergenic
966703222 3:182879518-182879540 CAGCATGGGCTGGTAGTGGATGG + Exonic
967118023 3:186359779-186359801 CAGTGTGGGATGGGAGTGGTAGG + Intronic
967775355 3:193380855-193380877 CAGTCTAGGCTGGGAGCAGAAGG + Intergenic
968583509 4:1405625-1405647 CAGTGGGGGCGGGGAGGTCACGG + Intronic
968958445 4:3730629-3730651 CAGTGGGGGCTGGGGGTGCAGGG + Intergenic
968958459 4:3730659-3730681 CAGTGGGGGCTGGGGGTGCAGGG + Intergenic
968978192 4:3832843-3832865 CAGGGTGAGGTGGGAGTTGCAGG - Intergenic
969098137 4:4749586-4749608 CAGTGAGGTCTGGGAGTTTGGGG + Intergenic
969213052 4:5702240-5702262 CAGAGTGGTCTGAGAGATGAGGG - Intronic
969429565 4:7146234-7146256 AAGTGTGGGCAGGGAGGAGAGGG + Intergenic
969823673 4:9740041-9740063 CAGTGCCGGCTAGGACTTGAGGG + Intergenic
969841354 4:9885013-9885035 CTGTCTGGGGTGGGAGTGGAGGG + Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
971725167 4:30302641-30302663 GAGTGTGGGATGGGAGTTTGGGG + Intergenic
972635765 4:40882726-40882748 AAGTGTGGGTTTGGAGCTGAGGG + Intronic
974686403 4:65236765-65236787 CAGTGTGGGCTGGCAGGTCAAGG - Intergenic
974977110 4:68905306-68905328 CAGTCTGGACAGGGATTTGAGGG - Intergenic
976009963 4:80475167-80475189 CAGTGTGGTATGGAAGTTGAAGG + Intronic
976783239 4:88785795-88785817 CAGTGTGGGCTGGGAGTTGAAGG + Intronic
977483380 4:97608627-97608649 CAGAGTGGGCTGGGACTTTAAGG + Intronic
979240172 4:118440879-118440901 CACTCTGAGCTGGGAGTTAAAGG - Intergenic
981104590 4:140866026-140866048 CAGTGAGAGCTAGGATTTGAAGG + Exonic
981462150 4:145025888-145025910 CAGTGTGAGCAGGCAGTTGATGG + Intronic
982166456 4:152617875-152617897 CAGTGTGGCCTGAGAGTGCAAGG - Intergenic
983824569 4:172242175-172242197 CAAATTGGGCTGGGAGTTGAAGG + Intronic
984173191 4:176385265-176385287 CTATGTGGGCAGGGAGTTGGGGG + Intergenic
985704268 5:1391526-1391548 CTATGTGGGCTGAGACTTGAAGG - Intergenic
988729064 5:33952077-33952099 CAGTATGGTCTGGGCCTTGAAGG - Intronic
991502510 5:67290950-67290972 CATTATGGGGTGGGAGTGGATGG + Intergenic
994288623 5:98000494-98000516 GAGTGGGGGCTGGGAGGTGTTGG - Intergenic
994458222 5:100041770-100041792 CAGAGAGAGCAGGGAGTTGAGGG + Intergenic
995070055 5:107910103-107910125 CAGTGTGGGATGGGGGTTTGGGG + Intronic
995598466 5:113772107-113772129 CAGAGTGGGCTGAGAGTTCCGGG - Intergenic
997879546 5:137577250-137577272 CTGTCTGGGCTGGGTGCTGAAGG + Intronic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
999424678 5:151476880-151476902 CAGTGAGGGCTGGCAGTGGCAGG - Intronic
999574248 5:152956675-152956697 CATTGTGGGCTAGGAGTAGCTGG - Intergenic
1001171177 5:169420154-169420176 CACCTTGGGCTGGGAGTGGAGGG + Intergenic
1001205262 5:169756328-169756350 CAGTGTCTGCTGCGAGTTGCTGG - Intronic
1002132070 5:177087661-177087683 CAGCTTGGGCTGGGAGTGGGTGG - Intronic
1002454354 5:179337840-179337862 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002454376 5:179337939-179337961 CAGAGTCAGCTGGGAGGTGAAGG - Intronic
1002740426 5:181431462-181431484 CACTCTGAGCTGGGAGTTAAAGG - Intergenic
1002913603 6:1510468-1510490 GAGTTTGGACTGGGAGCTGAGGG + Intergenic
1005482436 6:26267512-26267534 CTGTGTGAGGTGGGAATTGAAGG + Intergenic
1005693084 6:28326264-28326286 CAGTGTGGACTCGGAGATGCTGG + Exonic
1005957790 6:30676746-30676768 CAGGTGGGGCTGGGAGCTGATGG + Exonic
1006031383 6:31179173-31179195 CAGGGTGTGGTGGGAGATGAGGG - Intronic
1006980388 6:38142949-38142971 CCTTGTGGGCTGGGCATTGAAGG + Intronic
1007199588 6:40095414-40095436 CAGTGGGGAGTGGGAGTTGATGG + Intergenic
1008001175 6:46361340-46361362 CAGTGTGGCCTGGGAGTCAAAGG - Intronic
1008022976 6:46601464-46601486 CAGTGTGAGATGGGACTAGAGGG - Intronic
1008433648 6:51449830-51449852 CAGGCTGGGCTGGGTGTGGAAGG + Intergenic
1008542708 6:52559185-52559207 CAGTGGGGGCTGGGGGTTCTGGG - Intronic
1010126909 6:72443027-72443049 AAGTGTGGTCTGGGAGTGGAAGG + Intergenic
1011586251 6:88928408-88928430 TAGTGTGGGCTGGAGGCTGAGGG - Intronic
1013526503 6:110979401-110979423 ATCTTTGGGCTGGGAGTTGAAGG - Intergenic
1014111061 6:117619007-117619029 CACTGTGGCCTTGGGGTTGAGGG - Intergenic
1015263235 6:131262368-131262390 AAGGGTGGGCTTGGAGCTGAGGG + Intronic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1017130747 6:151106553-151106575 CAGGGTGGGGTGGGAGCTCAGGG - Intergenic
1017451679 6:154560050-154560072 CAGTGGGGGCCGGGGGGTGAGGG - Intergenic
1018307292 6:162471045-162471067 GAGTGTGGGCTGGGCGTGGTGGG - Intronic
1019245537 6:170707066-170707088 CACTCTGAGCTGGGAGTTAAAGG - Intergenic
1019590085 7:1826551-1826573 CAGAGAGGGGTGGGAGCTGAGGG - Intronic
1020834226 7:13128162-13128184 CAGCCTGGGCTGGGTGTGGATGG + Intergenic
1022873110 7:34500160-34500182 AAGTGGGAGCTGGGATTTGAAGG + Intergenic
1023908541 7:44538560-44538582 CAGAGTGGACTCGGGGTTGAAGG + Intronic
1024352123 7:48377047-48377069 CAGGGTGGGCTGGGAGTGAGGGG + Intronic
1027869069 7:83683274-83683296 CAGTGGGGGTTGGGAGTTGTTGG + Intergenic
1029642272 7:101828799-101828821 AAGTGAGGGCTGGGAGAGGAGGG + Intronic
1030131683 7:106207019-106207041 CAGAACGGGCTGGCAGTTGAGGG + Intergenic
1031129613 7:117816509-117816531 CAGTGAGGGTTGGCAGTTCATGG - Intronic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032159197 7:129497787-129497809 CAGTTTGTGCTGGGCCTTGAAGG + Intergenic
1033486194 7:141791230-141791252 CAGTGTGTGCTCGGAGATGCTGG + Exonic
1033827644 7:145211061-145211083 CAAAGTGGACTGGGAGTGGATGG + Intergenic
1034162294 7:149002486-149002508 CAGGGCAGGCTGGGAGTTGTGGG - Intergenic
1034347350 7:150395744-150395766 AAGTGTGGGCTGGGAGCAGTGGG + Intronic
1034465160 7:151223691-151223713 CAGTGGGGGCTGGAGGATGAGGG - Exonic
1034823042 7:154234781-154234803 CAGTATGGGCTGGGTGGAGATGG + Intronic
1034983274 7:155491582-155491604 GAGTGGGCGCTGGGAGTTCATGG + Intronic
1035034728 7:155887259-155887281 CACTGTGGGCTGGGGGTGGAAGG + Intergenic
1035234134 7:157485318-157485340 GAGTGTGGGCCGGGTTTTGAAGG + Intergenic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035502588 8:101139-101161 CACTCTGAGCTGGGAGTTAAAGG + Intergenic
1036645312 8:10608733-10608755 CAGTGCGGGCAGTGAGTTGGGGG - Exonic
1037118065 8:15249966-15249988 GAGTGTGGGTGGGGAGTTGGGGG + Intergenic
1037974544 8:23200278-23200300 CAGACTTGGCTGGGAGATGAGGG + Intronic
1038205798 8:25463840-25463862 CAGTGTGCCCTGTGAGTGGAAGG - Intronic
1038277641 8:26135091-26135113 CTATGAGGGCTAGGAGTTGAGGG - Intergenic
1038456085 8:27672672-27672694 CAGTGTGTGCAGGAAGTTGGTGG - Exonic
1038625213 8:29186043-29186065 CTTTGTGGGCTGTGAGGTGAGGG - Intronic
1039883178 8:41639486-41639508 GAGATTGGGCTGGGAGTTTATGG - Intergenic
1039906105 8:41787445-41787467 CAGGTTGGGCTGGGGGTTGGGGG - Intronic
1039969189 8:42307154-42307176 CAGCCTGGTCTGGGACTTGAAGG + Intronic
1041308844 8:56493360-56493382 CAGTGGGGGCGGGGACTTTAGGG - Intergenic
1043456132 8:80414229-80414251 CAGCCTGGGCAGGGATTTGAGGG + Intergenic
1044427407 8:92068466-92068488 TGGTGTGGGCTGGGCTTTGAGGG - Intronic
1044731063 8:95229054-95229076 GAGTGTGGGCAGGGCATTGATGG + Intergenic
1044924611 8:97199639-97199661 CAATGTGGGCAAGGAGCTGATGG - Intergenic
1045032168 8:98147571-98147593 CAGTGTGGGGTTGGAGATGGGGG + Intronic
1046846101 8:118918299-118918321 CAGTGGTTGCTAGGAGTTGATGG + Intergenic
1047168524 8:122466851-122466873 CAGTGTGGGGAGGGAGTGGGTGG - Intergenic
1049161966 8:141103549-141103571 CAGGGTGGGCTGGGACATGCTGG - Intergenic
1049255865 8:141613474-141613496 GAGAGTGGGCTGGGAGGAGAAGG + Intergenic
1049786116 8:144451623-144451645 TGGTGTGGGCTGAGAGTAGAGGG + Intronic
1051275096 9:15391108-15391130 CAGTGAGGGCTGAGAGGGGAAGG + Intergenic
1052786146 9:32830469-32830491 CAGTGTGGCCAGGAAGTTCAGGG + Intergenic
1052976048 9:34411040-34411062 CAGTGTGCCCTGGGAGTGGCTGG + Intronic
1053287217 9:36857653-36857675 CAGCCTGGGCTGGCAGGTGATGG - Intronic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1055607607 9:77987073-77987095 CAGTCTGGTCTGGCATTTGAGGG + Intronic
1056579803 9:87882720-87882742 GACTGGGGGCTGGGAGCTGAGGG + Intergenic
1057676083 9:97137284-97137306 CAGTGGGAGCTGGGGGTGGAGGG - Intergenic
1057968619 9:99530522-99530544 CAGTCTGAGCTGGGCCTTGATGG - Intergenic
1059457743 9:114410438-114410460 CAGAGCAGGCAGGGAGTTGAGGG + Intronic
1059458217 9:114413033-114413055 CATTTTGGGATGGGAGTTGGGGG - Intronic
1059634476 9:116157719-116157741 CCGTGTGGGGTGAGAGGTGATGG - Intronic
1060032736 9:120229360-120229382 CAGCGTGGTCTGTGAGTTCATGG - Intergenic
1060180003 9:121527436-121527458 CAGTGGGGGCTGGGGGCTGGGGG + Intergenic
1060629999 9:125147727-125147749 CAGGGAGGGCTGGGAGTTACCGG + Exonic
1060826354 9:126690301-126690323 CTGTGTGGGCTGGGGTTTGAAGG + Intronic
1061586660 9:131573925-131573947 CACTGTGGGCTGGGCGTTTAAGG - Intergenic
1062389850 9:136329643-136329665 CAGTGTGGGAAGGCAGTAGACGG - Intronic
1203605735 Un_KI270748v1:56270-56292 CACTCTGAGCTGGGAGTTAAAGG - Intergenic
1185545119 X:937378-937400 CAGTGGGTGCTGGGAGTCGCTGG + Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186727781 X:12375483-12375505 CACTGTGGGCTTGCAGATGAAGG - Intronic
1187126944 X:16462683-16462705 AAGTGTGGGTTTGGAGCTGAGGG + Intergenic
1187850738 X:23589355-23589377 CAGCGTGGGCTGGTGGCTGATGG - Intergenic
1189744306 X:44154313-44154335 CAGTGACTGATGGGAGTTGATGG + Intronic
1190336778 X:49267376-49267398 CTGGGAGGGCTGGGAGTTGGGGG + Intergenic
1190705103 X:53020947-53020969 CAGTGAGGGATGGGAGATGGGGG - Intergenic
1192410746 X:70930533-70930555 CAGTGTGGGCTTGGTGAGGAGGG - Intronic
1193708098 X:84847196-84847218 CAGGGTGGGCTGTGGGTGGAGGG + Intergenic
1196107512 X:111912506-111912528 CCGTCTGGGCTGGGAGCTCAAGG - Exonic
1198312603 X:135436529-135436551 CAGAGTGGGCCGCGAGTTGGCGG + Intergenic
1200267234 X:154653057-154653079 GGGTGGGGGCTGGGAGTTGGAGG - Intronic
1200373571 X:155755407-155755429 TAGTGTGGCATGGGAGTTGAGGG + Intergenic
1201463386 Y:14253531-14253553 CAGGGTGAGATGGGAGTTGTTGG + Intergenic
1201472235 Y:14346304-14346326 CAGGGTGGGGTGGGAGGGGATGG - Intergenic
1201722815 Y:17120260-17120282 CAATGTGTCCTGGGAGTAGACGG + Intergenic
1202387912 Y:24342708-24342730 CACTCTGAGCTGGGAGTTAAAGG - Intergenic
1202482875 Y:25327420-25327442 CACTCTGAGCTGGGAGTTAAAGG + Intergenic