ID: 976783415

View in Genome Browser
Species Human (GRCh38)
Location 4:88787985-88788007
Sequence CTGTAGGCACAGATTTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976783415_976783419 4 Left 976783415 4:88787985-88788007 CCTTAAAAAATCTGTGCCTACAG 0: 1
1: 0
2: 0
3: 16
4: 193
Right 976783419 4:88788012-88788034 GGGAACATCTGTATTTCCAGTGG 0: 1
1: 0
2: 1
3: 15
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976783415 Original CRISPR CTGTAGGCACAGATTTTTTA AGG (reversed) Intronic
905986544 1:42289092-42289114 CTTTAAGCACTAATTTTTTAAGG + Intronic
907142202 1:52198063-52198085 CTATAGGCAGAGATTTTCTTTGG + Intronic
908393206 1:63702256-63702278 CTGAAAGCACAGATTGTTTTCGG - Intergenic
911159555 1:94671039-94671061 TTGTAGGTAAAGATTTTTAAAGG + Intergenic
911335618 1:96576702-96576724 CTGTAAGCACATTTCTTTTAAGG + Intergenic
913113277 1:115674962-115674984 ATGTATGCACACATTTTTTTAGG + Intronic
914353871 1:146864813-146864835 CAGTAGGCTCATATTTTTTAAGG + Intergenic
914768190 1:150658477-150658499 CTATAGGAGCAGATTTATTATGG - Intronic
917104856 1:171482110-171482132 CTGTAGGCACTGAAATTTTACGG - Intergenic
918268090 1:182866504-182866526 CTGTAGCCACAGCTTTTTCCAGG - Exonic
918533090 1:185544764-185544786 CTGTCAGTACAGATTTTTTGGGG + Intergenic
918747208 1:188219221-188219243 ATTTAGGCTTAGATTTTTTATGG - Intergenic
919076193 1:192815943-192815965 TTGTAGGCAGATATTTTTAATGG + Intergenic
919603444 1:199650501-199650523 CTGGATTCACTGATTTTTTAAGG - Intergenic
921437508 1:215142759-215142781 CTGTAGGCTCTGAATTGTTATGG + Intronic
1063423537 10:5933584-5933606 TTGTGGGAACAGATTTTTTAAGG + Intronic
1063524972 10:6776803-6776825 ATGTATGCACATACTTTTTATGG + Intergenic
1064848713 10:19686022-19686044 CTGTAGGCAGTGAATTCTTATGG + Intronic
1065104240 10:22365100-22365122 CTGTAGGCATAAAATTATTAGGG + Intronic
1067196646 10:44125762-44125784 CTGTATGCACATGTTTTTTCTGG + Intergenic
1068543560 10:58322858-58322880 CTAAAGACACAGATTTTTAAAGG + Intergenic
1068716624 10:60195990-60196012 CTGAAGGCACAGATGTCCTAAGG + Intronic
1068782223 10:60932733-60932755 ATTTAGGCACATAATTTTTAAGG - Intronic
1069383693 10:67865145-67865167 CTGCAGGTACAGATTTTTAAAGG - Intergenic
1076414882 10:130278735-130278757 CTGTAGGCAGAGTTTTCTGATGG - Intergenic
1079282432 11:19099401-19099423 CTGTCTCCACAGATATTTTATGG - Intergenic
1080132108 11:28808349-28808371 ATGTAGCCACATATTTTTAAAGG + Intergenic
1080181164 11:29428075-29428097 CTGTAGACAAAGAGTTTTTAAGG - Intergenic
1080188806 11:29521817-29521839 CTGTAAGCACAGATTGCTTTTGG + Intergenic
1080441432 11:32298536-32298558 CAGTAGGCTCAGCTATTTTATGG - Intergenic
1080961213 11:37162572-37162594 CTGGCGGAACATATTTTTTAAGG - Intergenic
1081461699 11:43278421-43278443 CTGTAGGCTCAGAATTTACAGGG + Intergenic
1082214705 11:49554961-49554983 CTGAAGACACTGAGTTTTTAGGG + Intergenic
1084749324 11:71193784-71193806 CTGCAGGCACAGATTGTTCCAGG + Intronic
1087056900 11:93945599-93945621 CTGTTTGAACAGAATTTTTAGGG + Intergenic
1087184398 11:95172426-95172448 CTGTGAGCACTGATTATTTAAGG + Exonic
1090045472 11:123328419-123328441 CTGTAGGCATGGATAATTTAAGG - Intergenic
1091132257 11:133156312-133156334 CTGGAGGCACAGATTTCTACGGG + Intronic
1092179483 12:6435612-6435634 CTATAGTCACAGATATTTTGGGG + Intergenic
1092309162 12:7333676-7333698 CTGGATTCACTGATTTTTTAAGG - Intergenic
1093804558 12:23416229-23416251 CAGTGGGTACATATTTTTTATGG - Intergenic
1097508964 12:60511891-60511913 TTCTATGCCCAGATTTTTTAGGG - Intergenic
1098319611 12:69230071-69230093 CTCTACACACAGTTTTTTTAGGG - Intergenic
1100212981 12:92417316-92417338 ATATAAGCACAGATTTATTACGG - Intergenic
1100745915 12:97645604-97645626 CTGTAGGCACATATGTATTCTGG + Intergenic
1101363851 12:104053350-104053372 CTGTATGCACAGATTTTCCCTGG + Intronic
1104443261 12:128812615-128812637 CTGGAGGCCCACCTTTTTTAAGG + Intronic
1105666380 13:22561779-22561801 ATGTAGCCACAGGTTTTTTTTGG + Intergenic
1106075702 13:26459225-26459247 CTGTTGGGAAAGATATTTTAGGG + Intergenic
1108236190 13:48408481-48408503 CAGTGGGCACAGTTTTTATAGGG + Intronic
1109695772 13:65955221-65955243 CTGTAGGCCAATATTCTTTATGG - Intergenic
1110128003 13:71972260-71972282 ATGTGGGCACATATTTATTAGGG - Intergenic
1110216244 13:73027815-73027837 CTTTAGTCACAGATTCTTTATGG + Intergenic
1110554093 13:76839015-76839037 CTATAGGCACAGAGTTTGTCAGG + Intergenic
1113151490 13:107268854-107268876 CTGAAGGGCCAGATTTTTTAGGG + Intronic
1114438476 14:22727442-22727464 CTCTGGGAGCAGATTTTTTAAGG + Intergenic
1114936556 14:27546365-27546387 TTGTTGGCCCAGATTTATTAAGG - Intergenic
1115574181 14:34694781-34694803 CTCTAGGCAGAGATTTCTCAGGG - Intergenic
1118167885 14:63356068-63356090 TCCTAAGCACAGATTTTTTATGG + Intergenic
1120523573 14:85552100-85552122 CAGAAGTCACAGATTTTTTTAGG - Intronic
1121677758 14:95768187-95768209 ATGTGGACACAGATTTTTCAAGG - Intergenic
1122380680 14:101304333-101304355 TTGTGGGCACAGAGTTGTTATGG - Intergenic
1125263015 15:37848942-37848964 CTGGAGGCACAGCTTCATTAAGG - Intergenic
1125968892 15:43896069-43896091 CTGTGGGCACTGATTTCATAGGG - Intronic
1126826603 15:52557118-52557140 CTGGAGGTTCAGATTTCTTAAGG - Exonic
1131911595 15:97211154-97211176 CTGTAGCCACATATTTTAGATGG + Intergenic
1133075322 16:3275891-3275913 CAGTAGCCACACATTTTTTAAGG - Intronic
1133616099 16:7478374-7478396 CTAAAGGGAAAGATTTTTTAAGG + Intronic
1134775239 16:16847171-16847193 ATATAGGCAAAGATTTATTATGG - Intergenic
1135340554 16:21643269-21643291 CTGTAGGCACATATGTGTTGGGG - Intronic
1135372643 16:21918426-21918448 CTGAAAACACAGATTTTTTTTGG - Intergenic
1135439140 16:22452275-22452297 CTGAAAACACAGATTTTTTTTGG + Intergenic
1138857848 16:60716194-60716216 CTGTAAACACAGATTTTGAAAGG - Intergenic
1139980150 16:70850707-70850729 CAGTAGGCTCATATTTTTTAAGG - Intronic
1144935760 17:18897390-18897412 ATGGAGGAGCAGATTTTTTAGGG + Intronic
1145803586 17:27709767-27709789 CAGTAGGGTCAGACTTTTTATGG + Intergenic
1148235016 17:45962984-45963006 ATGTAGGGACAGAGATTTTAGGG + Intronic
1149649332 17:58267239-58267261 CTGTAAGCCCAGACTTTCTAGGG + Intronic
1150518531 17:65840567-65840589 GTCTAGGCAAAGATTTTTTTTGG + Intronic
1151156442 17:72126877-72126899 CTGTAGACACTGATTTTCTCTGG - Intergenic
1153099291 18:1447271-1447293 CAGTAGTCAAAGAATTTTTAGGG - Intergenic
1156716686 18:40020926-40020948 CTGCAGGCAAAGGTTTTTAAAGG - Intergenic
1157072779 18:44428930-44428952 CTGTAGTCCCAGATTATTTGGGG + Intergenic
1159218289 18:65426164-65426186 ATGTAGTCACAGATTTCATATGG + Intergenic
1160060352 18:75524213-75524235 CTGAAGGCACAGATATGGTAGGG + Intergenic
1162670918 19:12257201-12257223 CTGTAGTCACAGATTTGTATAGG - Intronic
1164790404 19:30972631-30972653 CTGTAGGCAGAAATTTGATATGG + Intergenic
1166398499 19:42460468-42460490 TTATAGGCACAGTTTTTTAAAGG + Intergenic
925494384 2:4429786-4429808 CTGTGAGCTCAGAATTTTTAGGG - Intergenic
925661416 2:6207244-6207266 CTGTGGGCAAAGATCTTTTAAGG + Intergenic
925751312 2:7092233-7092255 CTGTGGGTAGAGATTTTTCAAGG + Intergenic
926938264 2:18108007-18108029 CTGGAGGCATAGGTTTTTGAGGG + Intronic
929256622 2:39817949-39817971 CTGTAGGCAGAGAGTTCTCAAGG - Intergenic
931151498 2:59579384-59579406 CTGTGGACACTGATTTTTTATGG - Intergenic
935158706 2:100509404-100509426 CTGGAGGTTCAGATTTCTTAAGG + Intergenic
935437514 2:103051640-103051662 CTTTATACCCAGATTTTTTATGG + Intergenic
936247570 2:110842017-110842039 CTGTGAGCACAGTTTTTGTAAGG - Intronic
939135945 2:138293438-138293460 CTGTAATCACAAATTTTATAAGG + Intergenic
939223166 2:139329575-139329597 CTCTATGAAAAGATTTTTTAGGG + Intergenic
939483073 2:142773506-142773528 TTTTATACACAGATTTTTTAGGG + Intergenic
939653114 2:144788434-144788456 CTGGATTCACTGATTTTTTAAGG - Intergenic
941263967 2:163335896-163335918 ATGAAATCACAGATTTTTTAAGG + Intergenic
942373732 2:175313847-175313869 CTGTAGTCACAAATTATTTCTGG + Intergenic
944108026 2:196100509-196100531 CTTTAGGGAGAGATTTGTTAAGG + Intergenic
944829953 2:203523604-203523626 GTGTAGGCAAAAATTTATTAGGG + Intronic
948157792 2:235798466-235798488 CTATTGGCACTGTTTTTTTAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1168878639 20:1187286-1187308 CTTTTGGCACTTATTTTTTAGGG - Intronic
1169768806 20:9179093-9179115 GTATAGGCACAGATTTTTTGAGG + Intronic
1171058195 20:21928492-21928514 CAGTAGGCACAGATTTAATATGG + Intergenic
1172495008 20:35375017-35375039 CTCTAGGAACAGGTATTTTAAGG + Intronic
1176836908 21:13801509-13801531 CAGTAGACACAGATTTTCCAGGG + Intergenic
1177326868 21:19601971-19601993 ATGTAGGCAAAGAATTTTAATGG - Intergenic
1178243807 21:30933118-30933140 GTCTAGGCAAAGATTTTTTTGGG + Intergenic
1183245914 22:36693240-36693262 CTGTAGCCACATATTTGTAATGG + Intronic
1183727344 22:39597131-39597153 AAGTAGGCACAGATTTTCGAAGG + Intronic
951932194 3:27980964-27980986 ATGAAGGCACAGTTATTTTAAGG + Intergenic
952278991 3:31904792-31904814 CTGTAGACACAGATTTTGACAGG - Intronic
955429550 3:58828402-58828424 CTGGAGGCACAGAGATGTTAGGG + Intronic
956829377 3:73030580-73030602 ATGTAGGCACAGATTTGGTGGGG + Intronic
959645799 3:108699314-108699336 GTGTGGGCAAAGATTTCTTAAGG - Intergenic
961323530 3:126095620-126095642 TTATAGGAACAGATTTATTATGG - Intronic
962402612 3:135074407-135074429 TTGTAGTCCCAGATTTTATAAGG + Intronic
962960136 3:140303666-140303688 CTTCAGGCACAGATTTGTTCTGG - Intronic
963306414 3:143658607-143658629 TTGTGGGCAGAGATTTATTATGG + Intronic
967396592 3:189015875-189015897 CTGTAGGCACAGATCCCTCATGG + Intronic
968187859 3:196645765-196645787 CTGTGGGCAGGGGTTTTTTATGG - Intronic
970453563 4:16197881-16197903 TTGTGGGCAAAGATTTTTCAAGG + Intronic
972755405 4:42041423-42041445 CTACAGGCACACATGTTTTAAGG + Intronic
974707054 4:65532814-65532836 CTATAGGCATAGTTTTTTAATGG + Intronic
976783415 4:88787985-88788007 CTGTAGGCACAGATTTTTTAAGG - Intronic
976970602 4:91097080-91097102 CTGTGTGCACAGTTTTTTAATGG + Intronic
977380680 4:96269929-96269951 CTGTAGGCACCAATGTTATAGGG + Intergenic
977960999 4:103085391-103085413 CTGCAGCCACAGATTTTGTGAGG + Exonic
978377532 4:108091312-108091334 TTGGAGCCACATATTTTTTATGG - Intronic
978395458 4:108274707-108274729 CTGTAGGGAAAGTATTTTTAAGG - Intergenic
980245654 4:130236904-130236926 CTGAAGGCAAATGTTTTTTATGG + Intergenic
981834052 4:149034407-149034429 CTGTATGTACAGAATATTTAGGG + Intergenic
982426922 4:155274996-155275018 CTGTAGGTACAGATTACTTGTGG + Intergenic
983007641 4:162504239-162504261 CAGTAGGTAGAGATTCTTTATGG + Intergenic
983027042 4:162750833-162750855 CTGTATGCACAGATGTTTCATGG - Intergenic
984782788 4:183540997-183541019 CTTTAGAAACAGATTTTTAAAGG + Intergenic
986163960 5:5257393-5257415 CTGTTGGAACAGATTTCTTGGGG - Intronic
988213867 5:28246039-28246061 ATTTAGGCCCAGATTTTGTAGGG - Intergenic
988278793 5:29117103-29117125 CTGTATGTGCAGATCTTTTATGG + Intergenic
991182983 5:63776359-63776381 TTGCAGGCACAGATTTTAGAAGG - Intergenic
991434275 5:66580558-66580580 GTATAGGCATAGATTATTTAAGG - Intergenic
992808530 5:80362379-80362401 TTATAGGTACAGATTTTTGATGG - Intergenic
994440193 5:99792320-99792342 CTCTTGGAACAGATTTATTATGG + Intergenic
994441039 5:99802944-99802966 CTCTGGGCAAAGATTTTTTTGGG - Intergenic
997103025 5:130989392-130989414 CTGAAAGCACAGATTTTTGGGGG + Intergenic
1000281398 5:159785530-159785552 TTGTAGGCAAGGATTTTTAAAGG - Intergenic
1000392402 5:160737994-160738016 CAGCAGGCACAGTTTTTTCAAGG + Intronic
1000398945 5:160805016-160805038 ATGTATGCACAGCTTTTTTTTGG - Intronic
1002682974 5:180982400-180982422 CTGGAGGTTCAGATTTCTTAAGG + Intergenic
1004011023 6:11687413-11687435 CTTTAGGCACTGATTATATAAGG + Intergenic
1006952946 6:37840218-37840240 CTGTAGGCCCAGCTATTTTGGGG - Intronic
1009650372 6:66469152-66469174 GGGTAGGCACAGCTTATTTACGG - Intergenic
1009722011 6:67484408-67484430 CTGTGACCACAGATTTCTTAAGG - Intergenic
1010422653 6:75692269-75692291 CTGTAGTCACAGAAATCTTATGG + Intronic
1011379213 6:86724551-86724573 TTTTAGGCACAGATTCTTGAAGG + Intergenic
1011713467 6:90079214-90079236 CTGTAGACACAGATGTTGGAGGG - Intronic
1012432153 6:99175211-99175233 CTGCAGCCACAGATTTTGTGAGG - Intergenic
1012984083 6:105856388-105856410 CTCTAGGCACAGAGTGTATAAGG - Intergenic
1014783439 6:125590934-125590956 CTGTGGCTACATATTTTTTATGG - Intergenic
1015198333 6:130549453-130549475 CTGTATGCACCAATGTTTTAGGG + Intergenic
1015567008 6:134583909-134583931 TTCTAGGCACAGATATTTGAAGG + Intergenic
1019480742 7:1265569-1265591 TTGAAGGAACAGATTGTTTATGG + Intergenic
1020338696 7:7086382-7086404 CTGGATTCACTGATTTTTTAAGG + Intergenic
1020913020 7:14157140-14157162 CTCTACTCACAGATATTTTATGG - Intronic
1021496931 7:21285342-21285364 CAGTAGGCAACGATTTCTTATGG + Intergenic
1024743018 7:52375516-52375538 CTGTACACACACACTTTTTAAGG + Intergenic
1027005899 7:74692718-74692740 CTATAGGCACATATTATATATGG + Intronic
1027378217 7:77575726-77575748 CTGAAGACTCAGATCTTTTAGGG - Intronic
1027445775 7:78271899-78271921 CTAGATGCACTGATTTTTTAAGG + Intronic
1028201187 7:87963684-87963706 CTGTATGCTCAGTTTTGTTAAGG + Intronic
1028412341 7:90543876-90543898 AGGTAGGCAAAGATTTCTTAAGG + Intronic
1030891121 7:115000901-115000923 CTGGTGACACATATTTTTTAGGG + Intronic
1031722257 7:125191498-125191520 TTGTATGCACAGTTTTTTGAGGG - Intergenic
1032318581 7:130863877-130863899 GTTTGGGCAAAGATTTTTTAGGG + Intergenic
1032632042 7:133663934-133663956 CAGTAGGGGCAGATTATTTAGGG - Intronic
1033033899 7:137852643-137852665 CTGTAGCTTCATATTTTTTATGG - Intergenic
1033561277 7:142534553-142534575 GGGTAGGCAAAGATTTCTTAAGG + Intergenic
1033957742 7:146872744-146872766 CTGTATGCACAAATTGTTCAAGG + Intronic
1044390275 8:91641805-91641827 ATGTATGCACAGAATTTATATGG - Intergenic
1045253340 8:100499441-100499463 CTGTAACCACACATTTTCTAAGG - Intergenic
1046386973 8:113518484-113518506 CAGTAGTAACAGTTTTTTTATGG - Intergenic
1046496250 8:115018200-115018222 ATGTAGTCACAGATATTTTGAGG + Intergenic
1049950073 9:635201-635223 AGGCAGGCACAGACTTTTTAGGG - Intronic
1051523148 9:18012803-18012825 TTCTAGGCACAGAATATTTAAGG - Intergenic
1051848273 9:21477531-21477553 ATGAAGGCATAGTTTTTTTAAGG - Intergenic
1055046027 9:71925112-71925134 CTCTAGGGACACATTTATTAAGG + Intronic
1055381537 9:75712775-75712797 CTGTAGGAACAGAATCTTGATGG + Intergenic
1057461209 9:95263858-95263880 CTGTAGGAACAGGTATATTATGG + Intronic
1060445696 9:123685487-123685509 ATATAAGCACAGATGTTTTATGG - Intronic
1185916989 X:4046780-4046802 CTGAAAGCATATATTTTTTATGG + Intergenic
1186982467 X:14971948-14971970 CTGCATTCACTGATTTTTTAAGG + Intergenic
1187099239 X:16175422-16175444 CCCTAGGCACTGATTTTTGAAGG - Intergenic
1187653995 X:21448757-21448779 TTATAGGCACTGATTTATTAAGG + Intronic
1194069744 X:89306635-89306657 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1194715916 X:97286729-97286751 CTGTAGTCTCAGAGTTTTTCAGG - Intronic
1195601856 X:106757757-106757779 TTGCATACACAGATTTTTTAGGG - Intronic
1195719169 X:107849450-107849472 CTCTAGACACAGATTATTTCAGG - Intronic
1197367017 X:125575926-125575948 CTGTATGCTCAGTTTTTTTAGGG - Intergenic
1197459172 X:126718871-126718893 CTGTAGAAACAGTTTTATTAAGG + Intergenic
1198817457 X:140607894-140607916 CGGTAGGCAAAGATTTCTTAGGG - Intergenic
1200723891 Y:6640776-6640798 ATGGAGGAACAGATTTTTGAAGG + Intergenic
1201741476 Y:17328397-17328419 CTGGAGGCATTGAGTTTTTAAGG + Intergenic
1201858764 Y:18572750-18572772 CTGCAGGCACAGATTGCTTTTGG - Intronic
1201874557 Y:18747631-18747653 CTGCAGGCACAGATTGCTTTTGG + Intronic