ID: 976783768

View in Genome Browser
Species Human (GRCh38)
Location 4:88792458-88792480
Sequence TGGGAACCACTATGAATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976783768_976783775 26 Left 976783768 4:88792458-88792480 CCTGTTATTCATAGTGGTTCCCA 0: 1
1: 0
2: 2
3: 4
4: 94
Right 976783775 4:88792507-88792529 TTCTGCTTTCTGTCTTTAACTGG 0: 1
1: 0
2: 3
3: 29
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976783768 Original CRISPR TGGGAACCACTATGAATAAC AGG (reversed) Intronic
901879500 1:12185605-12185627 TGGGAACCATGCTGCATAACAGG - Intronic
907438848 1:54465953-54465975 GGGGAACCACTATGAATAAAAGG + Intergenic
911968821 1:104404273-104404295 TGAGAACCACTATTTATAATTGG - Intergenic
916124516 1:161557386-161557408 TGGGAACCCCCATTTATAACTGG - Intergenic
916134406 1:161638736-161638758 TGGGAACCCCCATTTATAACTGG - Intronic
919614387 1:199787170-199787192 TTGTAACCATTATGGATAACAGG - Intergenic
921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG + Intergenic
1064765166 10:18663300-18663322 TGGGTAACACTAGAAATAACTGG - Intronic
1066493537 10:35918344-35918366 TGGGAACCACAGTGAAGAAGTGG + Intergenic
1069215582 10:65814890-65814912 TGAGAACCACTATAAGTAAGAGG - Intergenic
1075352966 10:121742493-121742515 TGGGAAACAGGATGAAAAACAGG - Exonic
1080062473 11:27971571-27971593 TGGGACCCAGTATTTATAACTGG - Intergenic
1080400806 11:31933972-31933994 TAGGAAAAACTATGAATAAATGG - Intronic
1080451622 11:32382943-32382965 TGGGAACCACTATCAAAAGGAGG + Intergenic
1083297924 11:61725252-61725274 GAGGAACCTCTGTGAATAACTGG + Intronic
1083323974 11:61864006-61864028 TGGTAACCACTATGACCAAGTGG - Intronic
1095371808 12:41476752-41476774 TGGGAACCACCATCATTATCAGG - Intronic
1098425176 12:70355679-70355701 TGAGAAACACTATAAAAAACAGG + Intergenic
1108551670 13:51552106-51552128 TTGGAACCAATATGACCAACTGG + Intergenic
1111502514 13:89140134-89140156 TGGGCACAAATATGAAAAACTGG + Intergenic
1117138218 14:52759432-52759454 GGGGAACTACTATGAATAGGAGG - Intronic
1120487316 14:85130247-85130269 TGGGAAGAACTAAGATTAACTGG + Intergenic
1121696250 14:95914692-95914714 TGGCAGCCACTATGATTAAGTGG - Intergenic
1125524262 15:40365297-40365319 TGGGGACCACTATTAAAACCAGG - Intronic
1129050524 15:72777908-72777930 TGTGAACCAGTCTGAAAAACTGG - Intronic
1136302188 16:29343156-29343178 TGGGTATGACTAAGAATAACAGG - Intergenic
1152246367 17:79186776-79186798 TGGGCACCACTATAAATATCAGG + Intronic
1158026464 18:52903486-52903508 TGTGAACCACCATGGATAAATGG + Intronic
1158603569 18:58875613-58875635 AGGGAACCAGTATTAATCACAGG + Intronic
1159713313 18:71790920-71790942 TGGGTACCAACATCAATAACAGG + Intergenic
1164415952 19:28046586-28046608 TGAGAACGACTGTGAATACCTGG - Intergenic
1164415995 19:28046903-28046925 TGAGAATGGCTATGAATAACTGG - Intergenic
928202830 2:29261664-29261686 TGGGAAGCACTATCAAGAAAAGG - Intronic
931701644 2:64914004-64914026 TGGGAAACCCTAAAAATAACTGG - Intergenic
932059851 2:68485300-68485322 TGGGACACTCTAGGAATAACTGG - Intronic
932551319 2:72772502-72772524 TTGGATCCACAATGACTAACTGG - Intronic
932627690 2:73311758-73311780 TGGGAATGATTAGGAATAACTGG - Intergenic
934995185 2:98951041-98951063 TGGGAACCTATAGGACTAACTGG + Intergenic
938999897 2:136722156-136722178 TGGGGACTACTAGGAATAAAGGG - Intergenic
939260020 2:139795337-139795359 TGGGAACCATCAGGAAGAACGGG + Intergenic
939291837 2:140205903-140205925 TGGGAACAAGAATGAAGAACTGG - Intergenic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
940745322 2:157561190-157561212 TGGGAAAAACTATTAATAAAAGG - Intronic
946217056 2:218192548-218192570 TGGGAACCTATATGATTAACAGG + Intergenic
948817082 2:240517247-240517269 TGAGAACCTCTTAGAATAACTGG + Intronic
1172733154 20:37105625-37105647 TGGCAAACAATATGAATAAGAGG - Intronic
1173475195 20:43353729-43353751 TGGGGAGCCCTCTGAATAACAGG + Intergenic
1173666379 20:44766249-44766271 AGGGAACCACTATCAATTACTGG + Intronic
1174039727 20:47690333-47690355 TGGACACCAGTATGAATACCTGG - Intronic
1175037438 20:56013640-56013662 TGGTAACCACTAGGAATGAAAGG - Intergenic
1175249624 20:57601335-57601357 TGTGAGCCACTATCAATGACAGG + Intergenic
1181583437 22:23840276-23840298 TGTGAACCATTGTGAATAATGGG - Intergenic
951593975 3:24297245-24297267 TGCTAACCTCTTTGAATAACAGG + Exonic
952989636 3:38820617-38820639 TAGGTATCACCATGAATAACTGG - Intergenic
955621794 3:60872345-60872367 TTGGAACCAAAATGAATTACAGG - Intronic
956066535 3:65402610-65402632 TAGGAATCACTTTGAAAAACAGG - Intronic
956485890 3:69721693-69721715 TGGGAACCCCAATTTATAACTGG + Intergenic
957534152 3:81479448-81479470 TGAGAAGTACTAGGAATAACTGG + Intergenic
958789608 3:98635961-98635983 TTGGAACCAATATGGTTAACTGG + Intergenic
962368750 3:134803623-134803645 TGGGGACCAATATGTATAAAGGG - Intronic
963081690 3:141401111-141401133 TGGAATCCACTATTAACAACAGG + Intronic
972814117 4:42624921-42624943 TTAGAAACACAATGAATAACTGG + Intronic
974101728 4:57424432-57424454 TGGGAACCAATGTGACTCACAGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
978252923 4:106654937-106654959 TGAGAACCACTAAGAAAAGCAGG - Intergenic
978495071 4:109350246-109350268 TTGCAACCACTTTGAAAAACTGG - Intergenic
980919638 4:139070256-139070278 TGGAAAACACCATGAAAAACAGG - Intronic
985521300 5:375018-375040 TGTGAACCACTTTGACTAGCAGG + Intronic
985964576 5:3330206-3330228 TGAGAACCCCTGTGATTAACTGG + Intergenic
990862990 5:60348895-60348917 TGGGGACCACTAGGAAAAAGAGG + Intronic
991697816 5:69289387-69289409 TGGAAAACACTAAGAATACCTGG - Intronic
991731438 5:69593352-69593374 TGGGATGCACTATAAATAAATGG - Exonic
991807870 5:70448507-70448529 TGGGATGCACTATAAATAAATGG - Intergenic
991863512 5:71034501-71034523 TGGGATGCACTATAAATAAATGG + Intergenic
992332321 5:75729970-75729992 TATGAACCCCTATGATTAACAGG - Intergenic
995264485 5:110141571-110141593 TGGGAACCAATATAAAAAAGAGG + Intergenic
995849606 5:116531557-116531579 TGGGAATCACTATATCTAACAGG - Intronic
997466141 5:134089409-134089431 TGGGAACCACATTGGATAAGGGG - Intergenic
998889925 5:146735175-146735197 TGGGTAGCACAATAAATAACAGG + Intronic
1003221974 6:4168938-4168960 TGTTAACCACTCTGAATAAGGGG + Intergenic
1004145942 6:13066466-13066488 TGTGCACAACTATGAAAAACTGG - Intronic
1005044006 6:21624815-21624837 TGGGGATGACTATGAATCACTGG - Intergenic
1008936203 6:56995346-56995368 TGGGATCCAGAAAGAATAACAGG - Intronic
1013187698 6:107775172-107775194 TGTCAACAACTATAAATAACAGG - Intronic
1022533896 7:31084027-31084049 TGGAAACCCCTATGACCAACTGG - Intronic
1024638275 7:51308758-51308780 TGGTGCCCACTATGAATAAGTGG + Intronic
1027737177 7:81947692-81947714 TGGAAATCAATATTAATAACAGG + Exonic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1035670494 8:1413289-1413311 TGGGAAGCAGAATGAATAAATGG + Intergenic
1038704227 8:29878962-29878984 AGGGGACCACTGTGAGTAACGGG - Intergenic
1039310440 8:36312766-36312788 TGAGAACCACTGTTAATAAAAGG - Intergenic
1046160955 8:110363807-110363829 TGTTAACCACCATAAATAACTGG - Intergenic
1052364762 9:27599919-27599941 CAGGAACCACTAGGAATAAATGG - Intergenic
1055546080 9:77374949-77374971 TGGTAACCAGTATGAAATACTGG - Intronic
1061221888 9:129256967-129256989 CGGGAATCACTTTGAAAAACAGG + Intergenic
1190148131 X:47917305-47917327 TGGAAACCAGTACGAATGACAGG - Exonic
1193971544 X:88061468-88061490 TGGGAAAAACCATGAATAATGGG - Intergenic
1194046968 X:89019757-89019779 TTGCAACCACTATGAAGAACAGG + Intergenic
1199891995 X:152094318-152094340 TGGGCACAAGTAAGAATAACTGG + Intergenic
1200865173 Y:8035886-8035908 TGGGAACCTTTATGTATCACTGG + Intergenic