ID: 976786102

View in Genome Browser
Species Human (GRCh38)
Location 4:88823339-88823361
Sequence ATTGAGGAGCAGAAGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 469}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976786102 Original CRISPR ATTGAGGAGCAGAAGGAGTA GGG (reversed) Intronic
900038797 1:439841-439863 TCGGAGGAGCAGGAGGAGTAAGG + Intergenic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900818461 1:4868424-4868446 GAAGAGGAGGAGAAGGAGTAGGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902476104 1:16688709-16688731 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903000105 1:20259167-20259189 ATTATGGAGAAGAAGGAGGAAGG + Intergenic
903348546 1:22703681-22703703 CTTGAGGAGCAGAAAGAGTGTGG - Intergenic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
903788183 1:25875197-25875219 TGGGAGGAGCAGAAGGAGCACGG - Intergenic
904187099 1:28714087-28714109 TTGGAGGAGCAGAAGAAGCAAGG + Exonic
904216832 1:28927674-28927696 ATTTAAGAGGAGAAGGAGAAAGG - Intronic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
905393199 1:37651154-37651176 ATTGTGGAGCAGCAGGTGGAAGG - Intergenic
906013955 1:42556223-42556245 AGAGAGGGGCAGAAGGAGGAGGG + Exonic
906559150 1:46742223-46742245 ATTGTGGAGGAGCAGGAGGATGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
907270803 1:53289937-53289959 ATTGAGGGGAAGCAGGAGTGTGG - Intronic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908383655 1:63619985-63620007 ATTGAGGCTCAGAAGGACAAGGG + Intronic
909025758 1:70480022-70480044 ATTGAAGAAAAGAAGGAGGAAGG - Intergenic
910857870 1:91714087-91714109 AGTGAGTAGGAGAAGGACTACGG + Intronic
911151906 1:94604246-94604268 ATTGATGAGCAGCATGAGCATGG + Intergenic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911793844 1:102052905-102052927 ATTGAAGAGCAGAAGGGATATGG + Intergenic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912501550 1:110125863-110125885 ATTGAGGACCTGAATGAGTCAGG + Intergenic
913717912 1:121557203-121557225 ATTGAGGAATAGAAGCAGGAAGG - Intergenic
914860072 1:151378518-151378540 ATTCAGGATCAGAAGGAGTGTGG + Intergenic
915607268 1:156960473-156960495 AGTGTGGAGCAGAAGCAGTCAGG + Intronic
915825654 1:159073237-159073259 CTTCAGGAGGAGAAGGAGAAAGG - Exonic
916841761 1:168608579-168608601 ATATAGGAACAGAAGGGGTATGG - Intergenic
917604853 1:176616668-176616690 ATAGAGGAGCTTAAGAAGTATGG - Intronic
917719119 1:177769216-177769238 TTTGAGGAGAAGCAGGGGTAGGG - Intergenic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
918937481 1:190942038-190942060 ATTGAGGAGCAGTAATAGAAAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919676623 1:200389894-200389916 AATGAGGAGCAGAATGATGATGG - Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921681742 1:218041539-218041561 TTTGAGGAGAAGAAAGACTATGG + Intergenic
922026418 1:221753832-221753854 ACTGAGGCTCAGAAAGAGTAAGG - Intergenic
924816151 1:247443692-247443714 TGTGAGGAGGAGGAGGAGTATGG + Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063439365 10:6059953-6059975 GTTGAGGGGCAGATGGGGTATGG + Intronic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1064126031 10:12661068-12661090 GTTGAAAAGCAGAAGGAATAGGG - Intronic
1064312143 10:14221040-14221062 ATTGAGGAGCAGAGAGATTGAGG + Intronic
1064673893 10:17742394-17742416 ATTGAGGAGGACAAGGAGAGAGG + Intergenic
1064721975 10:18237965-18237987 AGTGGGGAGCAGAATGAGTGAGG - Intronic
1066099604 10:32106125-32106147 ATTGAGGAGGAAATGGAGTCTGG + Intergenic
1066442044 10:35448690-35448712 TTTGAGGGGCAGAGGGAGTGTGG + Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1068581166 10:58741267-58741289 ATTGATTTGCAGAAGGAGAAGGG + Intronic
1068628510 10:59275101-59275123 ATTTATGAGCAGAAGCACTATGG + Intronic
1069117462 10:64525709-64525731 AATGAGGAACAGAAAGATTAAGG - Intergenic
1069234962 10:66059586-66059608 ATTGAGGAGAACAAGGAGATGGG - Intronic
1069724244 10:70567160-70567182 ATGGCAGAGCAGCAGGAGTAAGG - Exonic
1070123316 10:73599383-73599405 ATTAAGGAGAAAAAAGAGTATGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070827386 10:79399158-79399180 ATGGAGGAGAAGAAGGACTGTGG + Intronic
1071326004 10:84518953-84518975 TTTTAGGAACAAAAGGAGTAAGG + Intergenic
1072153239 10:92700169-92700191 AGTGGGGAGCAGAAGAAGGATGG - Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1073788750 10:106918593-106918615 ATAGAGGAGGAGAGGGAGAAAGG + Intronic
1074339738 10:112615858-112615880 AGTGAGGTGCACAGGGAGTAAGG + Intronic
1074874032 10:117600641-117600663 AGGGAGGAGGAGAAGGAGAAGGG - Intergenic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075843047 10:125520638-125520660 ATTGATGAGGAGATGGAGTTTGG + Intergenic
1075894540 10:125983681-125983703 ATTGAGGAACAGAGGGAACAAGG + Intronic
1076039087 10:127227597-127227619 TTTCAGGTGCAGAAGGGGTAGGG - Intronic
1076965005 11:75752-75774 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077387099 11:2275197-2275219 TTTGAGGAGCTGCAGGAGGATGG - Intergenic
1078915268 11:15772924-15772946 AATGAGGAGCCTAAGGAGGAAGG + Intergenic
1079360845 11:19769249-19769271 ATTGTAGAGCAGAACCAGTACGG - Intronic
1079710512 11:23678106-23678128 TTTTAGGAGCATAAGGATTAGGG + Intergenic
1080140853 11:28918286-28918308 ATTGTGTAGCAGAAGAAGTTTGG + Intergenic
1081781830 11:45718428-45718450 AATGAGGAGTAGAAGGAGGCAGG - Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082821926 11:57549929-57549951 AATGAGGAGCAGAAGGTCAAAGG - Intronic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1083049999 11:59768602-59768624 GTTGATGAGCAGAAGGTGTCTGG + Intronic
1084045305 11:66564649-66564671 CTGGAGGTGGAGAAGGAGTAGGG + Intronic
1084772764 11:71354623-71354645 ATTCAGAGACAGAAGGAGTATGG - Intergenic
1085824066 11:79824468-79824490 ATTGAGGATCACAAAGATTAAGG + Intergenic
1085944970 11:81258405-81258427 ATTGAGGAGCAGAAAGGATTGGG + Intergenic
1086473871 11:87148595-87148617 TTTGAGGAGCAAAAGGGGAAAGG - Intronic
1089760876 11:120722314-120722336 ATTGAGGATCAGAAAGATTTTGG + Intronic
1089804998 11:121078739-121078761 CTAGAGCAGCAGAAGCAGTAAGG - Intronic
1089959697 11:122604881-122604903 AGTGAGCAGCAGAGTGAGTAGGG + Intergenic
1090490132 11:127153316-127153338 ATTGTGTAGGAGAAGGAGTGGGG + Intergenic
1090578103 11:128130837-128130859 AATGAAAAGCAGAAGGAGTTGGG - Intergenic
1090800632 11:130169450-130169472 ATTGTGGAGCTGAAGGGGTGGGG + Intronic
1090865178 11:130693652-130693674 GGTGCGGAGCAGAATGAGTAGGG - Intronic
1091113922 11:132996240-132996262 TTTGATGAGCAGTGGGAGTAAGG - Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091862998 12:3803644-3803666 ATGGGTGAGCTGAAGGAGTAAGG + Intronic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092463688 12:8709449-8709471 ATTGAGGGGCAGAAGCAGGCAGG + Intronic
1092505237 12:9092107-9092129 ACTGGGAAGCAGAAGGAGCAGGG + Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1094272018 12:28627338-28627360 GTTGAGAAGAAGAATGAGTAGGG + Intergenic
1096359114 12:50968129-50968151 AATGAGGAGGAGGAGGAGAAGGG + Intronic
1096664557 12:53154537-53154559 GCTGAGGAGCAGCAGGAGTGGGG + Intergenic
1097241188 12:57576362-57576384 ATTGATGAGCTCAAAGAGTAAGG + Exonic
1098571843 12:71996710-71996732 ATAGAGGAGAAGAAGAAATAAGG + Intronic
1100861464 12:98811322-98811344 ATGGATGTGCAGAAGGAGTCTGG - Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102966935 12:117135151-117135173 ATTCAGGAGCAGAGGCAGGAGGG - Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1104188865 12:126458632-126458654 ATTAAGGAGCAGAAGCAGTGTGG - Intergenic
1104268304 12:127259052-127259074 ATTGTGAAGCAAAAGGAGAAAGG + Intergenic
1105531142 13:21221740-21221762 ATTGGGGAGAAAAAGGAGCAGGG - Intergenic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1108494226 13:51008135-51008157 ACTGAAAAGCAGAAGGAGAAAGG - Intergenic
1108800783 13:54092444-54092466 AGTGAGGAGTAGCAGGAGCAGGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1108963047 13:56261018-56261040 ATTGATGAGTAGATGAAGTATGG + Intergenic
1110409564 13:75189324-75189346 ATAGAGGGGCAGAAGGAGTTTGG + Intergenic
1112717391 13:102202337-102202359 ATTGATGAGAAGAAGTGGTATGG + Intronic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114397976 14:22384063-22384085 AGTGAAGGGCAGAAGGAGTCTGG + Intergenic
1114502232 14:23179116-23179138 TTTGAGGAGAAGATGAAGTAGGG - Intronic
1115828242 14:37301749-37301771 TTTGAGTAGAAGAAGCAGTAGGG - Intronic
1116708583 14:48335564-48335586 ACTGAGGGGCAGAAGGATAAAGG - Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117581482 14:57155909-57155931 ATGGAGGAGCAGGAGGGGAAAGG + Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117832603 14:59767385-59767407 GGTGATGAGCAGAAGGAATATGG + Intronic
1118510959 14:66472739-66472761 ATTGAAAAGCAAAAGGAGAATGG + Intergenic
1118821204 14:69347255-69347277 ACAGAGGAGGAGAATGAGTAGGG - Intronic
1118825015 14:69372094-69372116 ATGGATGAGCAGGATGAGTAGGG + Intergenic
1119017247 14:71071561-71071583 ATGCTGGAGCAGAAGGAATAGGG - Intronic
1120281305 14:82441889-82441911 TTTTAGGAGCAGAATGAGTAAGG - Intergenic
1121256243 14:92532421-92532443 TGTGAGGACCAGAAGGACTAAGG - Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121802918 14:96790119-96790141 AAGGATGAGCAGAAGGAGTAGGG + Intergenic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1123068062 14:105628097-105628119 GGTGGGGGGCAGAAGGAGTAGGG - Intergenic
1124606183 15:31171921-31171943 CTTGAGGAGCCGGAGGTGTAGGG - Intergenic
1125581218 15:40787408-40787430 ACTGAGGAGCAGAAGGAAGTAGG + Intronic
1126361068 15:47846588-47846610 GAGGAGGAGAAGAAGGAGTAAGG + Intergenic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1127332502 15:57952663-57952685 TTAGAGGAACAGAAGGAGCATGG - Intergenic
1130857678 15:87855530-87855552 AGTGAACAGAAGAAGGAGTAGGG - Intergenic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131302853 15:91214833-91214855 ATTGAGGAGCAGAAAGAACGAGG - Intronic
1131875145 15:96798019-96798041 ATGGAGGAGGAGAAGGAAAAGGG + Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1132443117 15:101887764-101887786 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1133026597 16:2991379-2991401 ATTGGGGAGCAGAAGTGGTTTGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1134289234 16:12890419-12890441 AAAGAGGAGCAGAAAGAGTTGGG - Intergenic
1135049528 16:19181313-19181335 TTTGTGGAGCAGAAGGAGGTTGG - Intronic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1137725736 16:50655425-50655447 AGTGAGGATCAGAATGAGCAGGG - Intergenic
1137738685 16:50743091-50743113 ATTGAGGAGAAGAAGGTGGCAGG - Intronic
1139243021 16:65413272-65413294 AATGAGGCGCAGACGGAGCATGG + Intergenic
1139893524 16:70269842-70269864 ATTGAGGAGCATTAGCAGAAAGG + Intronic
1140141266 16:72260142-72260164 ATTGAGGAGGACAAGGACTCAGG + Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140902200 16:79379459-79379481 ACGTAGGAGCAGAAGTAGTACGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141216971 16:82033760-82033782 AATGAGGGGCAGGAGGAGGAAGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141367570 16:83457455-83457477 ATTGAAAAGCAGAGGGGGTAAGG - Intronic
1141852817 16:86659002-86659024 ACCGAGGAGCAGAAGAAGTCTGG + Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1143416517 17:6754844-6754866 AGTGAGGGTCAGAAGGATTAAGG + Intergenic
1143451573 17:7039855-7039877 GTTGAGAAGCAGAAGAAGTGGGG - Exonic
1143798922 17:9361505-9361527 GGTGAAGAGCAGCAGGAGTAGGG + Intronic
1145908307 17:28528342-28528364 ATTGAGCCACAGAAGGACTAAGG + Intronic
1146503813 17:33387270-33387292 ATTGAGGCTCAGAAAGATTAAGG + Intronic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149810324 17:59663218-59663240 ATTGGGCAGCTGAATGAGTAAGG + Intronic
1150979236 17:70122998-70123020 ATTTAAGAGCAGAAGGAGGGAGG - Intronic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155462552 18:26099234-26099256 ATTGGGTAACAGTAGGAGTATGG + Intergenic
1155505186 18:26526248-26526270 TTTGGGGAGCAGCAGGAGGAGGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1157138225 18:45079657-45079679 GTTGAGGATCCTAAGGAGTAGGG - Intergenic
1157556685 18:48617562-48617584 GCTGTGGAGCAGGAGGAGTAAGG + Intronic
1157615880 18:48987439-48987461 ATCTGGGAGCAGAAGGAGAAAGG - Intergenic
1159646909 18:70929963-70929985 ATTTAGGAGGAGATGGAGAAAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160641810 19:145382-145404 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1163710802 19:18845663-18845685 ACTGAGGACCACAAGGAGCAGGG - Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164441853 19:28284985-28285007 ATGAAGGAGAAGAAGGAGGATGG + Intergenic
1164718454 19:30412667-30412689 AAAGAGGAGAAGAAGGAGAAGGG - Intronic
1165132472 19:33641428-33641450 TTTGAGGAGCAGCAGGGTTAAGG + Intronic
1165203968 19:34168248-34168270 AGTGATGAGCATAAGGAGAACGG - Intergenic
1165940107 19:39410586-39410608 AGAGAAGAGGAGAAGGAGTAAGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166635995 19:44452402-44452424 AGAGAGGAGCAGGAGGAGCACGG + Intergenic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167724017 19:51198994-51199016 TTTGAGGAGAAGATGGAGCAGGG - Intergenic
1202710123 1_KI270714v1_random:14562-14584 ATTGAGGAAGACAAGGAGAAGGG - Intergenic
925443338 2:3907142-3907164 AAAGAGGAGAAGAAAGAGTAAGG - Intergenic
926839142 2:17059128-17059150 ATAAAGGAGCCGAAGGAGCAAGG - Intergenic
927577836 2:24215168-24215190 ACTGATGAGCAGAAGAAGAAAGG - Intronic
928267017 2:29820873-29820895 AGTCAGGAACAGAAGGAGAAGGG - Intronic
928890013 2:36193676-36193698 ATTGTGGAGAAAAAGGAGTAGGG + Intergenic
929015009 2:37485227-37485249 AATAAGGAGGAGAAGGAATATGG - Intergenic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932033083 2:68210370-68210392 AATGAGGAGTATAAGGAGTGTGG - Intronic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933719808 2:85390723-85390745 ATTGGGGAGCAGAAGGCTTGAGG - Exonic
934539260 2:95160458-95160480 ATTCAGGGGCAGATGGAGAAAGG - Intronic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
934884225 2:98010452-98010474 AGTGAGAAGCAGAAGGTGTGTGG - Intergenic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
938954162 2:136282986-136283008 ATTGGGGAGCAGAAGGGCTTTGG - Intergenic
938995057 2:136669634-136669656 ACAGAAGAGCAGAAGCAGTATGG - Intergenic
940120416 2:150258319-150258341 ATTCAGGAGAAGGAGGAGTTAGG - Intergenic
941775087 2:169384682-169384704 ATTGAGGAGCCAAATGAGTAAGG - Intergenic
941834944 2:170005724-170005746 GTTAAGGAGCTGAAGGACTAAGG + Intronic
941879872 2:170470244-170470266 ATTGAGGAGAAAAGGGAGAATGG - Intronic
943801732 2:192068474-192068496 ATTGAGGAGTAAAAGGATCAAGG + Intronic
944016925 2:195051726-195051748 AGAGAGGAGCTGAAAGAGTAGGG - Intergenic
944329832 2:198452671-198452693 TCTGAGGAGCAGCAGGAATATGG + Intronic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
946368724 2:219267076-219267098 AGTGGGGAGAAGAAGGAGGAGGG + Intronic
946480238 2:220048828-220048850 AGAGAGGAGTAGAAGGACTATGG + Intergenic
947559720 2:231138059-231138081 CTTGAAGAGCAGCAGGACTAGGG - Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169269009 20:4185183-4185205 ATTGAGGAGAAAGAGGAGAATGG + Intronic
1169311542 20:4546233-4546255 AGTCAGGAGCAGAGGGAGTGAGG + Intergenic
1169941492 20:10942600-10942622 ATTGAAGAGCAGAGGGAGGAAGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170427283 20:16247438-16247460 ATTGGGCAGAGGAAGGAGTAGGG + Intergenic
1170462650 20:16591941-16591963 ATAAAGGAAGAGAAGGAGTATGG + Intergenic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1170997432 20:21376700-21376722 AGTGAGGAGGAGAGGGAGAAGGG + Intronic
1171413690 20:24963340-24963362 ATGGAAGAGCAGAGGGAGCATGG - Exonic
1172167267 20:32907013-32907035 CCTGAGGAACAGAAGGAGTCAGG - Intronic
1172740760 20:37164800-37164822 AGTGAGGAGGAGAAGGAGCGAGG - Intronic
1173192563 20:40887502-40887524 ATCGAGGGGCAGAGGGAGCAGGG - Intergenic
1174029593 20:47611820-47611842 CTGGAGGGGCAGAAGGAGTGGGG - Intronic
1174846124 20:53944849-53944871 TTTGGGGAGGAGATGGAGTAAGG + Exonic
1175049785 20:56144430-56144452 AATGAGGCTCAGAAGGATTAAGG + Intergenic
1175690191 20:61059683-61059705 GGTGAGAAACAGAAGGAGTAGGG - Intergenic
1178524417 21:33314482-33314504 AATGAGGAGCAGAATCATTAGGG + Intergenic
1179228373 21:39476711-39476733 ATTGAGAAGTAGTAGGAATACGG - Intronic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179502903 21:41821169-41821191 ATGGAGGTGCACAAGGAGAAGGG - Exonic
1180593898 22:16961608-16961630 ATACAGGAGCAGAAGGTGAAGGG - Intergenic
1180628905 22:17213648-17213670 AATGAGGAGGAGAAGCAGCACGG + Intronic
1182512936 22:30832007-30832029 AAAGAGGAGCAGGAGGAGAAAGG - Intronic
1182551329 22:31102384-31102406 ATAGAGGCCCAGAAGGAGCAAGG + Intronic
1182764309 22:32747577-32747599 AGTGAGGCTCAGAAGGAATAAGG + Intronic
1182799533 22:33020303-33020325 ATTGAGAAGAAGAAGAAGTGAGG - Intronic
1183628631 22:39020226-39020248 ATTTAGGAGCAGGAGGGGTTTGG - Exonic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
949700271 3:6748673-6748695 AAGGAGGAGGAGAAGGAGAAGGG - Intergenic
950227697 3:11249429-11249451 ATTTAGGAGGAGAGGGAGAAGGG + Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950311202 3:11959504-11959526 ATTAAGGAAAAGAAGGAGAATGG - Intergenic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950904665 3:16527106-16527128 ATTGCAGAGAAGAAGGAGGAGGG + Intergenic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953240099 3:41141047-41141069 AGTGAGGGGCAGAGAGAGTAGGG - Intergenic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
954983288 3:54765602-54765624 AGTGAGGAGGAGGAGGAGTGTGG + Intronic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
955470462 3:59281636-59281658 ATGGGGGAGAAGAAGGAGGAAGG - Intergenic
956318514 3:67967778-67967800 GTTGGGGAGCAGATGAAGTAGGG + Intergenic
956392467 3:68788253-68788275 TTTGAGGAGCAGCAGTAGTGTGG - Intronic
956552873 3:70481278-70481300 TTGGAGGAAGAGAAGGAGTAGGG + Intergenic
957200329 3:77126671-77126693 ATTGAGAAAAAGAAGGAATATGG + Intronic
957387369 3:79514143-79514165 CTAGAGGAGCAGCAGGAATAAGG + Intronic
957562417 3:81839657-81839679 ATGGGGGAGGGGAAGGAGTAGGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
958799612 3:98740512-98740534 AGTGTGGAGGAGAAGGAGAATGG - Intronic
958908703 3:99969623-99969645 ATTGGAGAGCAGAGGTAGTAAGG + Intronic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963465182 3:145670438-145670460 ATAGAGAAGCAGAACCAGTAGGG - Intergenic
963828074 3:149977057-149977079 ATTGTGGAGCAGGAGGGGAAAGG + Intronic
963928714 3:150979190-150979212 GGAGAGAAGCAGAAGGAGTAGGG + Intergenic
964035553 3:152192304-152192326 ATTGAGGAGCAGAGAGAGACGGG - Intergenic
965478008 3:169181784-169181806 ATTGAGGAAAAGCAGGATTATGG + Intronic
965679181 3:171232862-171232884 AGGGAGGAGTTGAAGGAGTAGGG - Intronic
965848345 3:172990963-172990985 AGTGAGCAGCAGCAGGAGAAGGG + Intronic
967332820 3:188308966-188308988 AGGGAGGAGGAGAAGGAGAAAGG - Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
969520009 4:7671659-7671681 GCTGAGGAGCAGAAAGAATAAGG + Intronic
971276409 4:25201870-25201892 ATTGAGGAACAGATGGTGTTTGG - Intronic
973666553 4:53165082-53165104 ATCCAGGAGCAGCAAGAGTAAGG - Intronic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
976611063 4:87030865-87030887 AATGAGGAGCAAAAGGGGTCTGG + Intronic
976757791 4:88516749-88516771 ATTGAGAAGGAGGAGGAGTGGGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
976807260 4:89062389-89062411 TTTGAGTACCAGAAGGAGAAGGG - Intronic
978857994 4:113414991-113415013 ATTGAGGAACAGATGGTGTTTGG + Intergenic
979932068 4:126643210-126643232 ATGGAGGAGCAGAGGGATGAGGG + Intergenic
980723581 4:136728190-136728212 CTTGAGGAGAAGAAAGAGTGGGG - Intergenic
981201590 4:141986325-141986347 AATGAGGAAGACAAGGAGTAAGG + Intergenic
981224554 4:142278024-142278046 TTTGAGGAGCAGATGGTGTTTGG - Intronic
981342310 4:143635523-143635545 ATTGAGGATGAGGAGGAGCAGGG - Intronic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982560307 4:156921478-156921500 AAGGAGGAGGAGAAGGAGAAAGG + Intronic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
983928932 4:173432393-173432415 AGGGAGGAGAAGGAGGAGTAAGG - Intergenic
986765138 5:10918799-10918821 GTTGGGGAGCAGGGGGAGTAGGG - Intergenic
987200518 5:15572582-15572604 ATTGTGGACCAGCAGGCGTAAGG + Intronic
988624295 5:32854691-32854713 ATTTAGGAGAAGAGGAAGTAAGG + Intergenic
989960655 5:50410671-50410693 ATTGAGGAATAGAAGCAGGAAGG + Intronic
990647423 5:57859913-57859935 TTTAAGGAGCAGAACCAGTATGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991298385 5:65104093-65104115 AGCGGGGAGCAGAAGGAGTGCGG + Intergenic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
993160932 5:84290117-84290139 ATTGGGCAGGAGAATGAGTAGGG - Intronic
994200887 5:96974455-96974477 AATGTGGAGGTGAAGGAGTAGGG - Intronic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
994734179 5:103532104-103532126 ATTGGGGAGAAGAAGGGGTTAGG + Intergenic
995044666 5:107632230-107632252 AGTGAGGAGAAAAAGGAGAAAGG - Intronic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
995614598 5:113946820-113946842 ATTGAGAAGCCAAAGGAGAAAGG - Intergenic
995614901 5:113951019-113951041 ATTTAGGGGCAGAGGGAATATGG + Intergenic
996616703 5:125450626-125450648 ATTGAAGAGCAGAGGGAGGAAGG + Intergenic
996930967 5:128886616-128886638 ATTGAGAAGGAGAAGAAGTTGGG + Intronic
996952075 5:129139409-129139431 AATGAGGATGGGAAGGAGTAGGG - Intergenic
997462978 5:134067624-134067646 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
997508632 5:134437894-134437916 ATAGAGGAGCAGAAGCATCAGGG - Intergenic
997635981 5:135406434-135406456 AGTGAGGGGCAGAAAGAATAAGG + Intergenic
997670376 5:135666485-135666507 ATCGAGGAGCAGAAGGATGTAGG - Intergenic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000807709 5:165817182-165817204 ATTGTGGAGCAGAATGAGTTAGG + Intergenic
1001241667 5:170076049-170076071 ATGAAGGTGGAGAAGGAGTACGG + Exonic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002365032 5:178703182-178703204 GCTGAGGAGCAGCAGGAGTGAGG + Intergenic
1002735050 5:181379102-181379124 TCGGAGGAGCAGGAGGAGTAAGG - Intergenic
1002749476 6:95020-95042 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1002824344 6:759513-759535 ATTGAAGAGCAGTAAGAGAAAGG - Intergenic
1003479653 6:6519304-6519326 AGGGAAGAGCCGAAGGAGTAAGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1005394499 6:25367430-25367452 ATTGAGGAGCAGGAAGTGTGGGG + Intronic
1005677118 6:28165952-28165974 ATAGAGCAGATGAAGGAGTATGG - Intergenic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1005874351 6:29999784-29999806 ATTGAGGAGCAGGAGGGTGAAGG + Intergenic
1006056307 6:31387071-31387093 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1006066659 6:31467103-31467125 ATTGAGGAGCAGGAGGCTGAGGG - Intergenic
1007246729 6:40468673-40468695 ATAGAGGTGCTGAAGGAGCATGG + Intronic
1007622467 6:43223410-43223432 ATGCAGGAGCAGAAGGGGTCTGG - Intronic
1008499513 6:52166953-52166975 ATTGAGGAGAGGAAGCAGTGGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009828249 6:68896635-68896657 CTTGAGAAGCAGAAAGCGTATGG + Intronic
1009835385 6:68994117-68994139 ATTGAGGTGGAGAATGACTAAGG - Intronic
1011063200 6:83294761-83294783 ATTGAGGAGCAGGGGGAGTCGGG - Intronic
1011290461 6:85771779-85771801 ACTGAGGAGCATAAGGTGAAAGG + Intergenic
1011531421 6:88326409-88326431 ATTGAAGAGAAACAGGAGTAAGG - Intergenic
1012487576 6:99739286-99739308 AGAGAGGAGCAGAAGTAATACGG - Intergenic
1013070703 6:106726719-106726741 ATACATGAGCAGAAGTAGTAAGG + Intergenic
1013699609 6:112749319-112749341 ATTGAGGACTAGAAGAATTAGGG + Intergenic
1014425394 6:121298660-121298682 ATTGAGCAGCAGAAGAAGAGAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015455679 6:133424379-133424401 ATTCTTGAGCAGAAGGAGGAGGG - Intronic
1016307903 6:142702683-142702705 AATGAGGAAGCGAAGGAGTAGGG - Intergenic
1018147517 6:160906424-160906446 CTTGAGGAGCAAAAGTAGGAAGG + Intergenic
1019167646 6:170109162-170109184 TTTAAGGAGAAGAAGGACTAAGG - Intergenic
1019239309 6:170651419-170651441 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1020699345 7:11459220-11459242 ATTGAGGTCCAGAAGGTGAAGGG + Intronic
1021040288 7:15853679-15853701 ATTAAAGAGCAGCAGCAGTAAGG + Intergenic
1021131767 7:16920630-16920652 AGTCAGGAGAAGAGGGAGTAAGG - Intergenic
1021737948 7:23657457-23657479 GTTTAGAAGGAGAAGGAGTAGGG - Intergenic
1022227864 7:28382135-28382157 ATCCAAGAGCAGAAGGAGAAGGG + Intronic
1022248749 7:28586172-28586194 AGTGAGGACCACAAGGAGCATGG - Intronic
1022517717 7:30986682-30986704 AGTGAGGAGCAGGATGAGAAGGG + Intronic
1023168762 7:37369901-37369923 AAGGAGGATCAGAAGGAGTAGGG - Intronic
1023247392 7:38219726-38219748 ATTGAGAAACAGAGGGGGTAGGG - Intronic
1026401826 7:70021679-70021701 ATTGAGGAGCAGCAGGAAGGAGG - Intronic
1027978640 7:85188029-85188051 ATTTAAGAGCACAAGGTGTAGGG + Intergenic
1028246673 7:88487374-88487396 AAAGAGGAGGAGAAGGAGAAGGG + Intergenic
1028746322 7:94330899-94330921 ATTGCAGAGCAGAGGGAGAATGG - Intergenic
1028797036 7:94914827-94914849 AATGAGGAGCTGATGAAGTAAGG + Intronic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029925156 7:104308177-104308199 AATGAGTAGGAGAAGGATTATGG + Intergenic
1029967430 7:104754766-104754788 ATTAAGGAACAGGAGGAGCATGG + Intronic
1030469601 7:109947122-109947144 TTGGAGGAGGAGAAGAAGTAGGG - Intergenic
1031339424 7:120580430-120580452 CTTGTGGAGCAGAAGGTGGAAGG - Intronic
1031568424 7:123328065-123328087 ATAGGGGAGCATAAGAAGTAGGG + Intergenic
1033586696 7:142779641-142779663 ATGGAGGAGCAGGAGCAGGAGGG - Intergenic
1034135440 7:148763517-148763539 TTTGAGGAACAGAAGCATTAAGG - Intronic
1034366705 7:150556040-150556062 ACTGAGTATCAGAAGTAGTATGG + Intergenic
1035117352 7:156535827-156535849 ATTGAGCAGCAGGAGGAATTTGG - Intergenic
1035508461 8:155189-155211 TCGGAGGAGCAGGAGGAGTATGG + Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1037897102 8:22665148-22665170 GTGGAGGATCAGAAGGAGTGGGG + Intronic
1038050481 8:23805861-23805883 GTTGAGGAGCAGCAGGAGAGGGG - Intergenic
1038548042 8:28441220-28441242 GTGGAGGAGGAGAGGGAGTAGGG - Intronic
1038893803 8:31757925-31757947 ATAGAGGAGAAGGAGGAGTGAGG - Intronic
1039834657 8:41246900-41246922 AGTGAGGTGCAGAAGCAGCAGGG - Intergenic
1039839549 8:41284198-41284220 ATGGAAGAGGAGAAGGAGAACGG + Intronic
1042420152 8:68578902-68578924 ATTGGAAAGCAAAAGGAGTATGG - Intronic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1043150922 8:76714816-76714838 ATTGGTGAGCAGAATGAGTTAGG - Intronic
1044954758 8:97468407-97468429 TTTGAGGAACAGAAGAAGCAGGG - Intergenic
1045208274 8:100066861-100066883 ATTCAGGGGCAGATGGAGTCAGG - Intronic
1045233297 8:100326720-100326742 ATTAAGGCCCATAAGGAGTAAGG - Intronic
1046285894 8:112092485-112092507 AGTGAGGAGCAGCAGGGGCAGGG + Intergenic
1046366985 8:113246981-113247003 GTGGAGGACCAGAAGTAGTAAGG + Intronic
1046412653 8:113867375-113867397 AAGGAGGAGGAGAAGGAGAAAGG - Intergenic
1047084802 8:121504939-121504961 ATTCAGGAGGAGCAGGAGTGGGG - Intergenic
1047191901 8:122685987-122686009 ATGGTGGAGCAGAAAGCGTAAGG + Intergenic
1047650714 8:126917101-126917123 AATGAGGAATAGAGGGAGTAAGG - Intergenic
1048417556 8:134243627-134243649 AAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1048643163 8:136387345-136387367 AAGGAGAAGCAGAGGGAGTATGG - Intergenic
1051308385 9:15741286-15741308 GCTGAGGAGAAGAAGGAATAAGG - Intronic
1051522806 9:18009159-18009181 ATTGGGGAGGAGAAAGAGAAAGG - Intergenic
1051545376 9:18268479-18268501 ATTTAGGAGAAGAAGGAGCAGGG + Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053601179 9:39611077-39611099 ATTAAGAAGCAGACGCAGTATGG - Intergenic
1054252357 9:62731362-62731384 ATTAAGAAGCAGACGCAGTATGG + Intergenic
1054566472 9:66765861-66765883 ATTAAGAAGCAGACGCAGTATGG + Intergenic
1054763471 9:69023712-69023734 ATAGAGGAACAGAAGGAAAAAGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056546836 9:87620542-87620564 AAGGAGGAAGAGAAGGAGTAGGG + Intronic
1057003688 9:91536467-91536489 ATTGAGGGGTAGAAGCACTATGG + Intergenic
1057113914 9:92502063-92502085 GATGATGAGGAGAAGGAGTATGG + Intronic
1058988093 9:110228187-110228209 ATTGGGGAGCATATGCAGTAAGG - Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1060202920 9:121662292-121662314 ATTCAGGTCCAGAAGGAGTCAGG + Intronic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1060992296 9:127856097-127856119 ATTGGGGAGAAGAAGGGGTGAGG + Intergenic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062759517 9:138331710-138331732 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1203773176 EBV:59578-59600 TCTGAGGAGGAGAAGGAGAATGG + Intergenic
1203599964 Un_KI270748v1:2482-2504 TCGGAGGAGCAGGAGGAGTATGG - Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186264618 X:7818724-7818746 AGTGAGGAGGAGAGGGAGAAGGG + Intergenic
1186355511 X:8785131-8785153 ATTGAGGAGCAGGTGGTGTTTGG - Intergenic
1186855826 X:13625216-13625238 ATGGAGGTGCAGGAGGAGCAGGG - Intronic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1187029369 X:15469925-15469947 AGTGAGTGGCAGAAGGAGTATGG + Intronic
1187108413 X:16269504-16269526 ATTCAGGAAAAGCAGGAGTAAGG - Intergenic
1187259058 X:17668457-17668479 ATGCAGGAACAGAAGGAGTGAGG - Intronic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1188610291 X:32087771-32087793 ATTCACGAGCATAAAGAGTAAGG + Intronic
1188633141 X:32393326-32393348 ACTGAAGAGCATAAGGAGTTTGG + Intronic
1189244736 X:39554728-39554750 TTTGAGGAGCAGCAGGGGAAAGG - Intergenic
1190461980 X:50685690-50685712 ATTGAGGATTAGAATGAGAAAGG - Intronic
1191850138 X:65580188-65580210 ATTGAGGGGTAGGAGGAGTTGGG + Intergenic
1191905757 X:66087793-66087815 ATTGAGGAACAGATGGTGTTTGG + Intergenic
1192534767 X:71917836-71917858 ATTCAGGAGGAGAGGGAGCAAGG + Intergenic
1192779309 X:74277970-74277992 ATTGCTGAGAAGAAGGAGTTGGG - Intergenic
1193603691 X:83540238-83540260 AATGAGGACCAGTCGGAGTAAGG + Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1194349703 X:92810694-92810716 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1194366369 X:93018993-93019015 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic
1195408777 X:104546545-104546567 TTTGAGGAGCGAAAGGGGTAAGG + Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1197976443 X:132170915-132170937 AGTCAGGAGCAGAAGTAGCAGGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1199605357 X:149573908-149573930 AGTGAGGACCAGAGGGAGAAAGG - Intergenic
1199633764 X:149795460-149795482 AGTGAGGACCAGAGGGAGAAAGG + Intergenic
1199774192 X:150996524-150996546 AGTGAGGAGCAGAAGCAGGTTGG + Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200515239 Y:4136048-4136070 AATCAGGAGCAAAAGGAGTGGGG - Intergenic
1200658025 Y:5927297-5927319 ATTAAGGAGCAGCAGGAAAAAGG + Intergenic
1200674596 Y:6135255-6135277 AGTGAGGAGCAGCAGAAGCAGGG - Intergenic