ID: 976789819

View in Genome Browser
Species Human (GRCh38)
Location 4:88865790-88865812
Sequence GGTACGCGGGATTTGGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976789814_976789819 4 Left 976789814 4:88865763-88865785 CCTACAAAACTACTGACAAAAAT 0: 1
1: 1
2: 6
3: 44
4: 561
Right 976789819 4:88865790-88865812 GGTACGCGGGATTTGGCCTGTGG 0: 1
1: 0
2: 5
3: 32
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976789819 Original CRISPR GGTACGCGGGATTTGGCCTG TGG Intronic
900818717 1:4870021-4870043 GGTGCGAGAGACTTGGCCTGGGG + Intergenic
902208772 1:14889672-14889694 GGTGGGCTGGATTTGGCCTGTGG - Intronic
905473370 1:38209069-38209091 GGCAGGCCTGATTTGGCCTGTGG + Intergenic
908062388 1:60365796-60365818 GGAAGGCTAGATTTGGCCTGTGG - Intergenic
908407001 1:63824491-63824513 AGTGAGCTGGATTTGGCCTGGGG + Intronic
915360422 1:155283037-155283059 GGTTCGGGGGATGGGGCCTGGGG + Intronic
916478223 1:165190574-165190596 GGTAAGAGGAAGTTGGCCTGGGG - Intergenic
916988738 1:170219305-170219327 GGTAGGCTGGATTTGGCCGGTGG - Intergenic
917719565 1:177774190-177774212 GGCAAGCAGGGTTTGGCCTGTGG - Intergenic
918267432 1:182857428-182857450 AGTACGCTGGATCTGGCCAGAGG - Intronic
921121982 1:212145312-212145334 GGAAAGCCAGATTTGGCCTGTGG - Intergenic
924549367 1:245060853-245060875 GGTGGGCAGGATTTGGCCAGGGG - Intronic
1062823432 10:551363-551385 GGTAAGCGGGACGTGGCCTTTGG - Intronic
1062890506 10:1056581-1056603 GGTTCGCGGGAGGTGGCCTCGGG - Intronic
1063718617 10:8555799-8555821 GGCAGCCTGGATTTGGCCTGTGG + Intergenic
1065811270 10:29445917-29445939 GGTGGGCTGGATTTGGCCTACGG - Intergenic
1066604254 10:37143796-37143818 GGTAAGCTGAATTTGGCCTGTGG + Intronic
1067315628 10:45158679-45158701 GGTAAGCTGAATTTGGCCTGTGG + Intergenic
1068479593 10:57573327-57573349 TGTAAGTGAGATTTGGCCTGTGG - Intergenic
1068720219 10:60236987-60237009 AGTGCGCTGGATTTGGCCTGTGG + Intronic
1069373675 10:67772373-67772395 AGTGGGCTGGATTTGGCCTGTGG + Intergenic
1071371446 10:84955657-84955679 TTTACTCTGGATTTGGCCTGAGG + Intergenic
1072115167 10:92363924-92363946 AGTACCCGGTATTTTGCCTGGGG + Intergenic
1072724715 10:97805278-97805300 GGTGAGCCGGATTTGGTCTGTGG - Intergenic
1074038641 10:109766163-109766185 GGTAGGCTAGATTTGGCTTGAGG + Intergenic
1076264576 10:129099636-129099658 GGTGGGCTGGATTTGGCCTTTGG + Intergenic
1078664172 11:13310700-13310722 GGTGGGCTGGATTTGGCCTGCGG + Intronic
1080776407 11:35391110-35391132 GGCAAGCTGGATTTGACCTGTGG - Intronic
1085322425 11:75583342-75583364 GGGACGCGGGATCGGGCCGGTGG - Intergenic
1086075510 11:82846937-82846959 AGTGGGCTGGATTTGGCCTGGGG - Intronic
1088932913 11:114370040-114370062 AGTGGGCTGGATTTGGCCTGTGG + Intergenic
1090810713 11:130239536-130239558 GGTAGGCTGGAATTGGCCTGTGG + Intronic
1090851109 11:130571363-130571385 GGTGGGCTGGATTTGACCTGTGG + Intergenic
1092224415 12:6738210-6738232 AGTGGGCTGGATTTGGCCTGTGG - Intergenic
1092307026 12:7311651-7311673 GGCAGGCCAGATTTGGCCTGTGG - Intronic
1096517479 12:52165130-52165152 GGTAGCCAGGATCTGGCCTGGGG - Intergenic
1101053335 12:100886641-100886663 AATAGGCTGGATTTGGCCTGTGG - Intronic
1101371977 12:104138366-104138388 GGAACGCGGGACTGGGCCGGGGG - Intergenic
1102828681 12:115974090-115974112 GGGAGGCAGGATTTGGCCTGTGG - Intronic
1103023144 12:117552830-117552852 TGTGGGCTGGATTTGGCCTGTGG + Intronic
1103126642 12:118428813-118428835 GGTGAGCCAGATTTGGCCTGTGG - Intergenic
1103922500 12:124406254-124406276 GGTGGGCCGGATTTGGCCTGTGG + Intronic
1105799810 13:23893410-23893432 GGGAGGCTGAATTTGGCCTGTGG - Intronic
1105849237 13:24319622-24319644 GGGAGGCTGAATTTGGCCTGTGG + Intronic
1107365263 13:39665909-39665931 GTTGAGCTGGATTTGGCCTGTGG - Intronic
1108524264 13:51272518-51272540 GGCAGGCCAGATTTGGCCTGTGG - Intronic
1114010491 14:18361159-18361181 AGTAAGCTGAATTTGGCCTGTGG + Intergenic
1118860690 14:69660652-69660674 GGCAGGTAGGATTTGGCCTGTGG - Intronic
1120841573 14:89090054-89090076 GGCAGGCTGGATTTGGCCTGTGG + Intergenic
1121839902 14:97124928-97124950 AGTAGACTGGATTTGGCCTGTGG + Intergenic
1126666557 15:51080767-51080789 GGCAGGCCAGATTTGGCCTGGGG + Intronic
1127310364 15:57746788-57746810 GGTAGGCCAGATTTGGCCTGCGG + Intronic
1128707671 15:69849631-69849653 GGTGGGCGGGATTTGGCCGATGG + Intergenic
1129094367 15:73187703-73187725 AGTACACTGGATTTGGCCTGTGG + Intronic
1130926614 15:88390185-88390207 GGTGGGTTGGATTTGGCCTGTGG - Intergenic
1133388305 16:5388505-5388527 TGTGAGCTGGATTTGGCCTGTGG + Intergenic
1133461985 16:5994722-5994744 GGCACGCTGGATTTGGCCCATGG + Intergenic
1133694921 16:8253880-8253902 GGCAGGCTGGATTTGGCCTTTGG - Intergenic
1134689495 16:16181963-16181985 GGTGGGCTGGATTTGGCTTGGGG + Intronic
1134818339 16:17225002-17225024 GGTGGGCCGGATTTGGCTTGTGG + Intronic
1137979830 16:53060246-53060268 AGTAGGCTGGATGTGGCCTGTGG + Intronic
1138272903 16:55708997-55709019 GGTGGGTTGGATTTGGCCTGAGG + Intergenic
1140861010 16:79017847-79017869 GGTGGGCTGGATTTGTCCTGTGG + Intronic
1141044721 16:80705816-80705838 GGTGGGCCAGATTTGGCCTGTGG + Intronic
1143780299 17:9225663-9225685 GGCAGGAGGGATCTGGCCTGGGG + Intronic
1147787593 17:42990953-42990975 GGTTGGAGGGATCTGGCCTGTGG - Exonic
1149158334 17:53661163-53661185 GGCAGGCCAGATTTGGCCTGTGG + Intergenic
1149988731 17:61368358-61368380 GGTGTGCGGGAGCTGGCCTGAGG + Exonic
1151075057 17:71261963-71261985 GGTATGCTGAATTTGGCCTGTGG - Intergenic
1151182304 17:72338176-72338198 AGTGGGCTGGATTTGGCCTGTGG - Intergenic
1152393599 17:80017744-80017766 GGAAGGCTGGCTTTGGCCTGTGG + Intronic
1153597826 18:6746440-6746462 AGTAGCCTGGATTTGGCCTGTGG + Intronic
1154413044 18:14151846-14151868 GATAGGCTGGATTTGGCCTATGG - Intergenic
1154456154 18:14527986-14528008 GGCAGACTGGATTTGGCCTGTGG - Intronic
1154935716 18:21054378-21054400 GGTGGGTGAGATTTGGCCTGTGG + Intronic
1156373604 18:36492735-36492757 GGTACCCCCGATTTAGCCTGAGG - Intronic
1156450528 18:37263945-37263967 GGTGGGCAGGATTTGGCCAGTGG - Intronic
1157629809 18:49083207-49083229 GGCAGGCAGGATTTGGCCTGTGG + Intronic
1157761179 18:50266647-50266669 GGTCGGCGGGATTTGGCCGAGGG - Intergenic
1161010409 19:1957092-1957114 GGTGGGCGGGATTGGGCCTCTGG + Intronic
1161034478 19:2076789-2076811 GGTGCGCGGGCTTGGGGCTGAGG - Exonic
1161515560 19:4694370-4694392 GGTGGGCCGGATTTGACCTGTGG + Intronic
1161882913 19:6969714-6969736 GGTGGGCCAGATTTGGCCTGAGG + Intergenic
1161975589 19:7606393-7606415 GGTAGGTGGGGTTGGGCCTGGGG + Exonic
1163138704 19:15332121-15332143 GCTACGCGGGCTCGGGCCTGCGG - Intronic
1163516478 19:17767022-17767044 GGTGGGCGGGATTTGGCCCGTGG - Intronic
1164536202 19:29088007-29088029 GGTACTTGGGATCAGGCCTGTGG + Intergenic
1165074183 19:33271748-33271770 GGCAGGCTGTATTTGGCCTGGGG + Intergenic
1165204593 19:34172763-34172785 GGTACGCGGGACCGGGCCTCAGG + Exonic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166530276 19:43538543-43538565 GGTAGGCTGGATTTTGCCTATGG + Intergenic
927307211 2:21587235-21587257 GGTAGGCCAGATTTGACCTGAGG + Intergenic
927446620 2:23167924-23167946 GGTGAGCTGGATTTGGTCTGTGG - Intergenic
928498781 2:31864521-31864543 GGTGAGCTGGATTTGGCCTGTGG - Intergenic
931800136 2:65750103-65750125 GGTGGGCCAGATTTGGCCTGAGG + Intergenic
933087223 2:78069785-78069807 GGTGAGCTGGATTTGGTCTGTGG + Intergenic
933249458 2:80012666-80012688 GGCAGGCTGGATTTGGCCCGTGG + Intronic
933627567 2:84618969-84618991 GGTGGGCCAGATTTGGCCTGGGG + Intronic
934091897 2:88558175-88558197 GGCAGGCTGGATTTGACCTGTGG + Intronic
936960473 2:118068668-118068690 GGTAGGCTGAATTTGGCCAGAGG + Intergenic
937486427 2:122319774-122319796 TGTGGGCTGGATTTGGCCTGAGG - Intergenic
937636343 2:124159461-124159483 GGCAGGCCAGATTTGGCCTGTGG + Intronic
944766669 2:202871541-202871563 GGAACCCGGGATTTGGTCTCCGG + Intronic
945892958 2:215449668-215449690 GGTAGGCTGGATTTGGCCCCTGG - Intergenic
947444001 2:230149218-230149240 GGTAGGCTGGATTTAACCTGTGG - Intergenic
948134540 2:235626878-235626900 GGTGGGCTGGATTTGGCCTGTGG + Intronic
1169053612 20:2601196-2601218 AGCAGGCTGGATTTGGCCTGTGG - Intronic
1169309679 20:4524893-4524915 GGTGGGCTGGATTTGGCCTGGGG - Intergenic
1170596231 20:17807709-17807731 GGTAGGCAGGATTTGGCCCAAGG + Intergenic
1170634765 20:18094512-18094534 GGTTAGCCGGATTTGGCCTAAGG - Intergenic
1172917067 20:38451094-38451116 GGGACGTGGGATTTGGACCGGGG + Intergenic
1174542353 20:51299589-51299611 GGTAGGGCAGATTTGGCCTGTGG - Intergenic
1174698628 20:52585479-52585501 AGTGGGCTGGATTTGGCCTGAGG - Intergenic
1176859961 21:14006406-14006428 GATAGGCTGGATTTGGCCTATGG + Intergenic
1179377615 21:40864953-40864975 GGAACAGGGCATTTGGCCTGTGG - Intergenic
1180434984 22:15291959-15291981 AGTAAGCTGAATTTGGCCTGTGG + Intergenic
1180517194 22:16155774-16155796 AGTAAGCTGAATTTGGCCTGTGG + Intergenic
1181481989 22:23205849-23205871 AGTGGGCTGGATTTGGCCTGTGG + Intronic
1181729510 22:24834354-24834376 GGAAGGCTGGATTTGGCCCGAGG - Intronic
950190947 3:10975734-10975756 AGTAGGCAGAATTTGGCCTGTGG + Intergenic
950460524 3:13119635-13119657 GGTGGGCTGGATGTGGCCTGGGG + Intergenic
951692976 3:25416715-25416737 GGTAGGCTGGATTTGGCCTTTGG + Intronic
953133640 3:40164216-40164238 GGTATGCAGGATATGGGCTGTGG - Intronic
953221554 3:40976398-40976420 GGTAGGCTGGATTTGGCCTGTGG - Intergenic
955132169 3:56181323-56181345 GGTGGGCTGGATTTGGTCTGTGG - Intronic
957020100 3:75117103-75117125 GGTAGGCTGAATTTGGCCTGTGG + Intergenic
957024394 3:75165034-75165056 GGCAGACTGGATTTGGCCTGTGG - Intergenic
960825755 3:121782467-121782489 AGCAGGCTGGATTTGGCCTGTGG - Intronic
962208039 3:133451543-133451565 GGTGAGATGGATTTGGCCTGTGG + Intronic
963023993 3:140900398-140900420 GGTGGGCAGGATTTGGCCTGTGG - Intergenic
963059463 3:141213074-141213096 AGTAGGGTGGATTTGGCCTGTGG - Intergenic
963164645 3:142188578-142188600 AGTAGGCTGGATTTGGCCTGTGG - Intronic
963926890 3:150960360-150960382 GGTAAGAGGGATTTGGCCCATGG + Intronic
966005988 3:175012619-175012641 GGTGGGCCAGATTTGGCCTGAGG - Intronic
966366429 3:179192769-179192791 GGTGAGTTGGATTTGGCCTGTGG + Intronic
968352058 3:198066065-198066087 GGTAGGCAGGATTTGGCCTGTGG - Intergenic
968472643 4:789104-789126 GTCACGCCGGACTTGGCCTGAGG + Intronic
968904456 4:3445029-3445051 GGCAGGCAGGATTTGTCCTGGGG + Intronic
969070546 4:4534892-4534914 AGTGGGCCGGATTTGGCCTGTGG + Intronic
970203741 4:13634712-13634734 GGTAGACTGGATTAGGCCTGTGG - Intergenic
975642221 4:76512020-76512042 GGTCCGAGGGAGTGGGCCTGAGG + Intronic
976789819 4:88865790-88865812 GGTACGCGGGATTTGGCCTGTGG + Intronic
984973638 4:185210724-185210746 GGTACGCGGGCTTGGGGGTGAGG - Intronic
985138994 4:186819921-186819943 GGTATGCAAGATTTGGCCTGTGG + Intergenic
985552987 5:542674-542696 GGTCCAGGAGATTTGGCCTGAGG - Intergenic
990958159 5:61364358-61364380 GGCAGGCCAGATTTGGCCTGTGG - Intronic
991512355 5:67393659-67393681 AGTAGGCCAGATTTGGCCTGCGG + Intergenic
992005978 5:72477887-72477909 GGTGGGCTGGATTTGACCTGAGG + Intronic
995880629 5:116841044-116841066 GGTATGCAAGATTTGGCTTGAGG - Intergenic
997312693 5:132901846-132901868 GGTAGGTTGGATTTGGCTTGTGG - Intronic
997889951 5:137667080-137667102 GGCAGGCTGGATTTGGCCTGTGG - Intronic
998985544 5:147752424-147752446 TGCAGGCTGGATTTGGCCTGTGG - Intronic
999649500 5:153751439-153751461 GGCAGGCTGGATTTGGCCTGGGG - Intronic
1000311472 5:160049081-160049103 GGCAGGCTGGATTTGGCTTGTGG - Intronic
1002086349 5:176778053-176778075 GGTAGGCCAGATTTGGGCTGTGG - Intergenic
1002708434 5:181179176-181179198 TGCAGGCTGGATTTGGCCTGAGG - Intergenic
1002965864 6:1965951-1965973 GGTAGGTCGGATTTGGCCTGTGG - Intronic
1003249752 6:4415823-4415845 GGTTCTGGGGATTTGGCCTTGGG - Intergenic
1005304909 6:24504425-24504447 AGTGGGCTGGATTTGGCCTGAGG - Intronic
1007839360 6:44703002-44703024 GGTACACAGGATGGGGCCTGTGG + Intergenic
1007840158 6:44709498-44709520 GGTGGGCTGGATTTGGCCTATGG - Intergenic
1012405190 6:98888184-98888206 AGTAGGCTGGATTTGGCCTGTGG - Intronic
1012752371 6:103180143-103180165 GGTAGGCCAGATTTGGCCTGTGG - Intergenic
1016844102 6:148554119-148554141 GGGAGGATGGATTTGGCCTGGGG + Intergenic
1017540391 6:155396490-155396512 GGCGAGCTGGATTTGGCCTGTGG - Intronic
1017563940 6:155664077-155664099 GGCAGGCTGGATTTGACCTGTGG + Intergenic
1018074955 6:160203732-160203754 GGTGGACTGGATTTGGCCTGTGG + Intronic
1023404615 7:39819733-39819755 GGCACACTGGATTTGGCCTATGG + Intergenic
1024270230 7:47636184-47636206 TGTACCCGTGGTTTGGCCTGTGG + Intergenic
1028657875 7:93231884-93231906 GGCGCGCTGGGTTTGGCCTGAGG - Intergenic
1030178725 7:106682302-106682324 GGTAGGCTGGATTTGGTCTTTGG - Intergenic
1030354475 7:108526812-108526834 GGTGGGCTGGATTTGCCCTGAGG - Intronic
1031984289 7:128153093-128153115 GGCAGCCTGGATTTGGCCTGCGG - Intergenic
1034232126 7:149538754-149538776 GGTACATGGGAATTGGCATGGGG + Intergenic
1035401446 7:158568984-158569006 GGTGTGAGGGATTAGGCCTGTGG + Intronic
1040083520 8:43313307-43313329 GGGAGACTGGATTTGGCCTGTGG + Intergenic
1041391622 8:57352023-57352045 GGTAGGCTGGATTTGGTCTGTGG + Intergenic
1042405980 8:68406094-68406116 GTGAAGCAGGATTTGGCCTGGGG + Intronic
1045416490 8:101972860-101972882 GGTAAGCTGGATCTGGACTGAGG + Intronic
1046847435 8:118933746-118933768 GGGATGTGGGATTGGGCCTGGGG + Intronic
1047425718 8:124743829-124743851 AGTAGGCCAGATTTGGCCTGTGG - Intergenic
1047425851 8:124745868-124745890 GGTAGGCCAGATTTGGCCTGTGG - Intergenic
1047426666 8:124752706-124752728 GGTGGGCCAGATTTGGCCTGTGG - Intergenic
1047647058 8:126880274-126880296 GGCAGGTGGGATTTGGGCTGTGG + Intergenic
1053003983 9:34592375-34592397 GGCACAAGGGATCTGGCCTGGGG - Intergenic
1053501861 9:38603474-38603496 GGTAGGCAGGATTTGGCCTGTGG - Intergenic
1054981280 9:71209658-71209680 AGCAGGCTGGATTTGGCCTGTGG - Intronic
1055862996 9:80776177-80776199 GGTGGGCCAGATTTGGCCTGTGG + Intergenic
1057154234 9:92826242-92826264 GGTAGGCAGGATTTGGCCTGTGG + Intergenic
1057681240 9:97187770-97187792 GGTAGGCAGGATTTGGCCTGTGG - Intergenic
1060669374 9:125455734-125455756 AGTGGGCTGGATTTGGCCTGTGG + Intronic
1186460881 X:9747862-9747884 AGAACGCCGGATTTGTCCTGAGG + Intronic
1186673513 X:11791885-11791907 GGCAGGCAGGATTTGTCCTGTGG + Intergenic
1186753161 X:12642557-12642579 AGTAGGCCAGATTTGGCCTGTGG - Intronic
1189504399 X:41596389-41596411 GGCCAGCTGGATTTGGCCTGAGG + Intronic
1189941663 X:46129823-46129845 TGTGGGCTGGATTTGGCCTGTGG - Intergenic
1189952836 X:46249903-46249925 GGTGGGCTGGATTTGGCCTGTGG - Intergenic
1192847222 X:74918810-74918832 GGCAGGCCAGATTTGGCCTGTGG + Intronic
1194497459 X:94635339-94635361 TGTACGTGGTATTGGGCCTGTGG + Intergenic
1197258534 X:124291014-124291036 GGTAGGCAGGATTTGGCCTAAGG - Intronic
1199555595 X:149105207-149105229 GGTGACCGAGATTTGGCCTGTGG - Intergenic