ID: 976794154

View in Genome Browser
Species Human (GRCh38)
Location 4:88913415-88913437
Sequence AAGTAGTAGTAGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 494
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 441}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976794154 Original CRISPR AAGTAGTAGTAGAGGGAAGA GGG Intronic
900830163 1:4959988-4960010 AAGGAGGTGGAGAGGGAAGAGGG + Intergenic
901991505 1:13118167-13118189 AAGTTGGTGTAGAGGTAAGAGGG - Intergenic
904295769 1:29518898-29518920 AAGAAGAAGGAGAAGGAAGAAGG - Intergenic
904582496 1:31556131-31556153 CAGTATTACTAGAGGTAAGATGG - Intergenic
905148260 1:35904944-35904966 AACTAGTAGTTGGGGGATGATGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180828 1:43817431-43817453 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906350952 1:45058807-45058829 AAGTAGGAGGAGAAGGAAGTGGG + Intronic
906539592 1:46575033-46575055 AAATAGGAGGAGAGGGAAAAGGG + Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907790679 1:57660514-57660536 AAGGAGTAGTGCAGGCAAGATGG + Intronic
908320395 1:62972804-62972826 AAGGAGGAGGAGAGGGAAGGAGG + Intergenic
910351696 1:86306096-86306118 AAGAAGTGGTGGAGGGTAGAGGG - Intergenic
910787419 1:91015474-91015496 GACTATTAGTAGAGAGAAGAAGG - Intronic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
911905535 1:103563996-103564018 AAGTGTTAGTAGAGCGAAGGCGG + Intronic
912322547 1:108727781-108727803 AAGCAGGAGCAGAGGGAAAATGG - Intronic
912692549 1:111815299-111815321 AAGAAGGAGAAGAGGAAAGAAGG - Intronic
914799787 1:150952367-150952389 AGGTGATAGTAGAGGTAAGAAGG + Intronic
914914146 1:151807996-151808018 AAGGATTAGTAATGGGAAGAGGG - Intronic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
918306715 1:183252880-183252902 AAGGAGTTGTGGAGGCAAGAGGG - Intronic
918768732 1:188523869-188523891 AAGGTGTAGTAGAAAGAAGAAGG + Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919267300 1:195286333-195286355 AAGAAGAAGAAGGGGGAAGAAGG - Intergenic
919491039 1:198205040-198205062 AAGTAGGAGAAGAAGGAAGGGGG - Intronic
920664440 1:207951179-207951201 AAGTGGTAGTGGAAGGTAGAGGG - Intergenic
922651339 1:227341601-227341623 AAGGAGAAGCAGAGGGATGAGGG + Intergenic
923639514 1:235739942-235739964 AAGTAGTGGGAAAGGGAAGATGG + Intronic
1063082593 10:2782665-2782687 AGGTAGGAGGAGAGGGGAGACGG - Intergenic
1063575752 10:7260511-7260533 AAGAAGCAGCATAGGGAAGAGGG - Intronic
1063993009 10:11586759-11586781 AAGTATAAATAGAGGCAAGAGGG + Intronic
1064674435 10:17747213-17747235 ATGTAGTAAGATAGGGAAGAGGG - Intergenic
1065332947 10:24622394-24622416 AAGTAGTAGTGACAGGAAGAGGG + Intronic
1066498365 10:35964815-35964837 ATGTAGTAGTAAGGGGCAGAGGG - Intergenic
1066626084 10:37407087-37407109 ATGTAGTAGTAAGGGGCAGAGGG - Intergenic
1068138832 10:52978361-52978383 AGGTAGAAGTTGTGGGAAGAGGG - Intergenic
1070079985 10:73176507-73176529 AAGTAATAGAACAGGGAAGATGG + Intronic
1070244969 10:74722099-74722121 GAGTAGTTGTAGAGGGAAAGTGG - Intergenic
1070761947 10:79029442-79029464 GAGAAGTAGTAGAAGAAAGAAGG - Intergenic
1071427963 10:85578578-85578600 AAGGAGAAGCAGAGGGAAGTGGG + Intergenic
1071887084 10:89963088-89963110 AATTTCTAGAAGAGGGAAGAGGG + Intergenic
1073399411 10:103244537-103244559 AAGTTGTAGTAGAGGGCACGAGG + Intergenic
1074962081 10:118455889-118455911 AAATAGTAGACCAGGGAAGAAGG - Intergenic
1076088220 10:127654658-127654680 GAGGAGTGGTAGAGGGAAGGAGG - Intergenic
1076102035 10:127790310-127790332 AAGTTGTATGAGAGGGAGGAGGG - Intergenic
1076410771 10:130248028-130248050 AAGTAGCAGTACAGGAAATAGGG + Intergenic
1077531347 11:3097075-3097097 AAGGAGGAGAAGAGGAAAGAGGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078151595 11:8764250-8764272 AAGAAGCAGTAGAGGGTAGAGGG + Intronic
1078534566 11:12162693-12162715 AAGTAGTAGTAGTGGCAGCAGGG - Intronic
1079208074 11:18434947-18434969 AAGCACTAGTAGAGATAAGAAGG - Intronic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1080103760 11:28490032-28490054 GAATAGAAGGAGAGGGAAGAAGG + Intergenic
1080175999 11:29363903-29363925 AAATAATAGGAGAGAGAAGAGGG + Intergenic
1081151476 11:39638398-39638420 AAGGAGTAGCAAAGGGAAGATGG + Intergenic
1081199356 11:40198020-40198042 AAGTAGGATAAGTGGGAAGATGG + Intronic
1081997856 11:47376624-47376646 AAGAAGGAGGACAGGGAAGAGGG - Intronic
1083673807 11:64314520-64314542 AAGTAGTAGAACTGGGAACAGGG + Intronic
1085165977 11:74399389-74399411 AGGAAGTTGTTGAGGGAAGATGG + Intergenic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1086246794 11:84762599-84762621 AAGAAGTAGAAGAGAGAAAAAGG - Intronic
1086247120 11:84766733-84766755 AATTAGTAGGGGAGGAAAGATGG + Intronic
1086588923 11:88488567-88488589 AAGTTGAAGGAGATGGAAGAAGG - Intergenic
1086783176 11:90932110-90932132 AGGTAGTGGTGGAGAGAAGATGG - Intergenic
1089114123 11:116080374-116080396 AAGGAACAGCAGAGGGAAGAGGG - Intergenic
1089800844 11:121025073-121025095 AAGTTGTAGTTGAGGAAAGTTGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090850043 11:130564032-130564054 GAGTATAAGGAGAGGGAAGAGGG + Intergenic
1091412016 12:248032-248054 AAGCAGGAGGAGAGGGAAGGGGG + Intronic
1091775763 12:3183734-3183756 AAGTAGTTTTAGAGGGAACTCGG + Intronic
1092028215 12:5261057-5261079 AAGCAGAAGTGGAGAGAAGAGGG + Intergenic
1093304797 12:17502048-17502070 AAGTACAAGTACAGGGAAGCTGG - Intergenic
1094619249 12:32064558-32064580 AAGAAGAAGGAGAGGGAAGAAGG + Intergenic
1096564070 12:52461533-52461555 AATTAAAATTAGAGGGAAGATGG + Intergenic
1096624920 12:52888845-52888867 AAGTAGAAGTGGAGGGTACAGGG - Intergenic
1096661787 12:53129902-53129924 TGGTAGGAGGAGAGGGAAGAGGG - Intergenic
1097230722 12:57508693-57508715 AGGTAGAGGTAGAGGGTAGAGGG + Intronic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1098856725 12:75661165-75661187 AAGTGATAGAAGAGGGGAGAAGG - Intergenic
1098967995 12:76814272-76814294 AAGTAGTAGTGGGGGAAAGATGG + Intronic
1099418815 12:82426875-82426897 GTGTTGTGGTAGAGGGAAGATGG - Intronic
1100697277 12:97108976-97108998 AAGTAGTAGTGCAGTGAGGATGG - Intergenic
1100864331 12:98840330-98840352 AAGTAATAGCAGAAGGAAAAGGG - Intronic
1101054960 12:100903015-100903037 AAGTGGCAGAAGAGGGAAAAGGG - Intronic
1101106756 12:101448133-101448155 GAGTTGTAGAAGAGGGATGATGG - Intergenic
1106223277 13:27765460-27765482 AAGTTGGAATAGTGGGAAGAAGG - Intergenic
1106537630 13:30661657-30661679 AGGTAGTAGTATTGGGAGGAAGG + Intergenic
1106550151 13:30764078-30764100 AATGAGAAGTAGAGGGGAGATGG - Exonic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106978109 13:35246813-35246835 AGGTGGTAGTATAGGGAGGATGG + Intronic
1108281171 13:48863726-48863748 AAGGACAAGTACAGGGAAGAAGG - Intergenic
1109260422 13:60138780-60138802 AAGAAGGGGAAGAGGGAAGAGGG + Intronic
1109966549 13:69706251-69706273 AAGAAGGAGTAGAGAAAAGAAGG - Intronic
1110461031 13:75746015-75746037 AAGCAGTAGTCCAGGCAAGAGGG + Intronic
1110504229 13:76266484-76266506 AGGTATTAGCAGAGGCAAGAAGG - Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112142499 13:96660908-96660930 AGGTAGAAGAAGTGGGAAGAAGG + Intronic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1112490511 13:99859090-99859112 AAGGAGGAGTAGCAGGAAGAAGG + Intronic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1114926087 14:27401253-27401275 AGATAGTAGTAAAGGTAAGAAGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115102438 14:29718788-29718810 AAGTAGTAGTAGGGCTGAGAAGG + Intronic
1115428384 14:33287605-33287627 AAGTAGTAGGAGAGGGATGCAGG - Intronic
1115742146 14:36399630-36399652 TGGTAGAAGGAGAGGGAAGAAGG - Intergenic
1116377410 14:44221191-44221213 AAATAATAGTAGAAAGAAGAAGG + Intergenic
1116539090 14:46075570-46075592 AAGTAGTAGTAGGGTGGAGGGGG - Intergenic
1117630216 14:57683646-57683668 AAATAGTAGTAAAGGGGAAAGGG - Intronic
1118009447 14:61594468-61594490 ATGTAGTAGTTGTGGGGAGATGG + Intronic
1120747653 14:88166540-88166562 AAGTTCTGGTAGAGGGAAGTGGG - Intergenic
1120781762 14:88491988-88492010 AATAAGTAAAAGAGGGAAGAGGG - Intronic
1121017448 14:90557124-90557146 AGGTAGAAGCAGAGGGCAGATGG - Intronic
1122012665 14:98764519-98764541 AACTAGTAGTACAGGAAGGAAGG + Intergenic
1122392799 14:101401846-101401868 ACGAAGAAGAAGAGGGAAGAGGG - Intergenic
1122487243 14:102089359-102089381 AAGAAGTTGTGGAAGGAAGAAGG - Intronic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1123791463 15:23724643-23724665 AAGCAGAATTAAAGGGAAGATGG - Intergenic
1124354016 15:28981988-28982010 AAGGACTACTAGAGGGCAGAGGG + Intronic
1125489357 15:40135678-40135700 AAGGAGAAGTACAGGGAAAATGG + Intergenic
1125499057 15:40226397-40226419 AAGTTGTAATAGTAGGAAGATGG - Intergenic
1125542020 15:40475075-40475097 AGGTAGGGGTAGAGAGAAGAAGG + Intergenic
1125843206 15:42825147-42825169 AAGGAATATGAGAGGGAAGAGGG + Intronic
1125890078 15:43259073-43259095 AGGTAGAAAGAGAGGGAAGATGG + Intronic
1126339841 15:47627178-47627200 AAGTAGGAGGAGTGGGAGGAAGG + Intronic
1126644030 15:50857005-50857027 AAGAAAGAGCAGAGGGAAGATGG + Intergenic
1126674817 15:51151732-51151754 AAGAACTACTAGAGGGAGGAGGG + Intergenic
1127514906 15:59683808-59683830 AACCAGTAGCAGAGGAAAGAGGG + Intronic
1127636262 15:60873000-60873022 AAGAAGGAGAAGAGGAAAGAGGG - Intronic
1128095618 15:64952324-64952346 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1128095631 15:64952461-64952483 AAGAAGAAGGAGAAGGAAGAAGG - Intronic
1130667442 15:85881568-85881590 AAGGAGTAGTGGAAGGAAGAGGG - Intergenic
1130702114 15:86194695-86194717 AGTTAGTATAAGAGGGAAGATGG + Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1134410342 16:13998684-13998706 AAGAAGAGGAAGAGGGAAGAAGG + Intergenic
1135073854 16:19376304-19376326 AGAAAGTTGTAGAGGGAAGAGGG + Intergenic
1135655090 16:24241409-24241431 AAGGAGCAGTAGAGGGAAAAGGG + Intergenic
1135935862 16:26779442-26779464 AGGCAGAAGTAGAGGAAAGAAGG - Intergenic
1136004905 16:27322733-27322755 AAGTATTAGAAGAGAGAAGGTGG - Intronic
1136049569 16:27640810-27640832 CAGTAGTGCTAAAGGGAAGACGG + Intronic
1137704872 16:50528000-50528022 AAATAGGAGTAGAAGAAAGAGGG - Intergenic
1137748642 16:50842008-50842030 AAGCAGTGGTAGAGGAGAGAAGG + Intergenic
1137924460 16:52526687-52526709 CAGGCGTAGTAGAGAGAAGAGGG + Intronic
1138337849 16:56267138-56267160 AGGTAGAAGAAGAGGGAGGAGGG + Intronic
1138938410 16:61759432-61759454 CAGTAGTAGGAGGAGGAAGAGGG + Intronic
1140833569 16:78773265-78773287 AAGTTGTAGTAGAAGGAACATGG - Intronic
1141155471 16:81593927-81593949 AGGTAAGGGTAGAGGGAAGAGGG - Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141400298 16:83741557-83741579 ATATAGTAATAGATGGAAGATGG - Intronic
1141527065 16:84618324-84618346 AAGGAGAAGGAGAGAGAAGAGGG - Intergenic
1143610385 17:8014580-8014602 AACTAGCAGTAGAAGGAAGCTGG - Exonic
1143671005 17:8396155-8396177 AAGGAATACTAGAGGGAAAAAGG + Intronic
1144157382 17:12519289-12519311 AAGTACTATTAGAGTGCAGAGGG - Intergenic
1144335184 17:14262283-14262305 ACGGAGTAGCCGAGGGAAGACGG - Intergenic
1144371453 17:14595463-14595485 AAGTGCTTGTAGAGGGAACAGGG + Intergenic
1145898418 17:28474196-28474218 AAGCAGCAGCAGAGTGAAGAGGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146866399 17:36338632-36338654 AAGTAATAGGAGAGATAAGAGGG + Intronic
1147069269 17:37939244-37939266 AAGTAATAGGAGAGATAAGAGGG + Intergenic
1147080797 17:38018781-38018803 AAGTAATAGGAGAGATAAGAGGG + Intronic
1147096740 17:38142741-38142763 AAGTAATAGGAGAGATAAGAGGG + Intergenic
1147571435 17:41573458-41573480 GAGTATTCTTAGAGGGAAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1149845068 17:60004226-60004248 AAGTAATAGGAGAGATAAGAGGG - Intergenic
1149890135 17:60381727-60381749 AAGTAATAGGAGAGATAAGAGGG - Intronic
1149986617 17:61352532-61352554 GAGTAGAAGTGGAGGGAAGGAGG + Intronic
1150677773 17:67259563-67259585 AAGGAGGGGTAGAGGGAAGGAGG + Intergenic
1151111403 17:71682343-71682365 CAGCAGTAGGATAGGGAAGAAGG - Intergenic
1151784441 17:76268500-76268522 AGGGAGTAGTGGAGGGAGGAGGG + Intronic
1153057650 18:963140-963162 AAGTAGTAGAACAGTGAAAAAGG + Intergenic
1153733786 18:8043662-8043684 AGGAAGCAGGAGAGGGAAGAGGG - Intronic
1155260494 18:24037755-24037777 AGGTAGTAGTAAAGGGTAGTTGG + Intronic
1157070965 18:44407846-44407868 AAGTAGTAAAAGAGGAAAAAAGG + Intergenic
1157214701 18:45773176-45773198 AAGGAGAAGGAGAGGGAAGGAGG - Intergenic
1157242183 18:46020958-46020980 AGGAAGTAGTAGAGAGAATACGG + Intronic
1157877320 18:51285991-51286013 AACTAGTAGGAAGGGGAAGAGGG - Intergenic
1158058733 18:53313027-53313049 AAGAAGGAGGAAAGGGAAGAAGG + Intronic
1158249132 18:55467265-55467287 AAGTTCAAGGAGAGGGAAGATGG - Intronic
1158684303 18:59599079-59599101 AAGTAGTAGTAGAAGAAGAAAGG - Intronic
1159748301 18:72268032-72268054 AAGTAGGATTAGAGGCAAGAAGG - Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1159985800 18:74839815-74839837 AAGGAATAGAAGAGGGAATAGGG + Intronic
1160816886 19:1040202-1040224 AAGGACTCGGAGAGGGAAGAAGG + Intronic
1162357100 19:10193065-10193087 AAGTAGTAGTTAAGGCATGATGG + Intronic
1163044726 19:14631870-14631892 AAGTGGAAGTAGCAGGAAGAGGG + Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163759069 19:19124066-19124088 AAGTAGTATTAGAAGACAGAAGG + Intronic
1164718720 19:30415366-30415388 AAGAAGGAGAAGAAGGAAGAAGG - Intronic
1165482528 19:36073173-36073195 AAGCAGAGGAAGAGGGAAGAGGG + Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166299764 19:41907075-41907097 ATGTAGGAGAAGAGGGGAGACGG - Intronic
1167607426 19:50488915-50488937 AAGAAATGGGAGAGGGAAGAAGG + Exonic
1167805580 19:51781620-51781642 AGGTACTAGTTGAGGGAAAATGG + Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
1167867152 19:52337497-52337519 GAGAAGGAATAGAGGGAAGAGGG + Intronic
1167889633 19:52528924-52528946 GAGAAGGAATAGAGGGAAGAAGG + Intronic
1167890751 19:52537237-52537259 GAGGAGTAATAGAGGGAAGAAGG + Intronic
1167898779 19:52602454-52602476 GAGAAGTAATAGAGGGAAGAAGG + Intronic
1167903111 19:52637103-52637125 GAGAAGGAATAGAGGGAAGAAGG - Intronic
1167913627 19:52723192-52723214 GAGAAGCAATAGAGGGAAGAAGG - Intronic
1167921256 19:52785182-52785204 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1167940306 19:52941400-52941422 GAGAAGTAATAGAGGGAAGAAGG - Intronic
1168464973 19:56594951-56594973 AAGTAGGAGAGGTGGGAAGAAGG - Intergenic
925395470 2:3530227-3530249 TAGTAGTACTACGGGGAAGAAGG + Intergenic
925395489 2:3530369-3530391 TAGTAGTAGTATGGGGAAGAAGG + Intergenic
925395500 2:3530443-3530465 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395504 2:3530480-3530502 TAGTAGTAGTACGGGGAAGAAGG + Intergenic
925395517 2:3530585-3530607 TATTATTAGTAGGGGGAAGAAGG + Intergenic
925395536 2:3530757-3530779 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395547 2:3530860-3530882 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395553 2:3530923-3530945 TATTAGTAGTAGTAGGAAGAAGG + Intergenic
925395566 2:3531029-3531051 TAGTAGTAGTATGAGGAAGAAGG + Intergenic
925395577 2:3531103-3531125 TATTAGTAGGAGGGGGAAGAAGG + Intergenic
925395582 2:3531137-3531159 TAGTAGTAGGATGGGGAAGAAGG + Intergenic
925534998 2:4906949-4906971 AAGTAAAAGTAGAGGTAAAATGG - Intergenic
925623880 2:5822457-5822479 AAGTAGTAAGAGTGGGAAAAAGG - Intergenic
926210537 2:10866167-10866189 CAGGAGGAGGAGAGGGAAGAGGG - Intergenic
926276892 2:11410739-11410761 AAATAGGCATAGAGGGAAGAGGG - Intergenic
926639068 2:15215817-15215839 AACTAGTGGTAGAGGGAGGATGG + Intronic
926647752 2:15307917-15307939 AAGTAGTAGGAAAGGCAAAATGG - Intronic
927097316 2:19757447-19757469 AAGAAGCAGGAGAAGGAAGATGG + Intergenic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
928615911 2:33039446-33039468 ATGTAGTATAAGAGGTAAGAAGG - Intronic
929304173 2:40341058-40341080 ATGGAGTAGTAGAGAGAAGAGGG + Intronic
929441477 2:41968601-41968623 AATTTGTCCTAGAGGGAAGAGGG - Intergenic
929795855 2:45058038-45058060 AGGTTGAAGTTGAGGGAAGAGGG - Intergenic
929898422 2:45981460-45981482 AAGCAGAAGGAGAGAGAAGATGG - Intronic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930763992 2:55065313-55065335 AAATAGCAGTAGAAGGCAGATGG - Intronic
931471144 2:62538827-62538849 AAGCAGTAGCAGTGGGAATAAGG + Intergenic
931471966 2:62547445-62547467 TAATATTAGTAGTGGGAAGAGGG - Intergenic
931597695 2:63967766-63967788 AAGGGGTAGCAGAGGGATGAGGG + Intronic
931737783 2:65213333-65213355 AATTAGGAGTAGAGGGAATAAGG - Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
934653263 2:96104224-96104246 AAGGAGGAGGAGGGGGAAGAGGG - Intergenic
936503026 2:113081505-113081527 AGGTGGGAGTAGTGGGAAGAGGG + Intergenic
937688468 2:124724759-124724781 AAGTAGTATTAGTGGGAGGGAGG + Intronic
937755866 2:125538139-125538161 AAGGAGTAATGGAAGGAAGATGG + Intergenic
938807718 2:134822407-134822429 ACCTAGTAGTAGAGGGAATCTGG - Intergenic
939212734 2:139197790-139197812 AAGAAGGAGTGTAGGGAAGAGGG + Intergenic
941995997 2:171602528-171602550 AGGAAGTAGGAGAAGGAAGAGGG - Intergenic
942276170 2:174325673-174325695 ATGTAGTAATAGAGAGAAAAAGG + Intergenic
942592223 2:177558360-177558382 AAGTAGGAATCGAGGGAATAGGG + Intergenic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943398814 2:187377970-187377992 AATTAGTAGAAGAAGGAAGTTGG + Intronic
943518241 2:188913243-188913265 AAGTAGTCATTTAGGGAAGAGGG - Intergenic
943809904 2:192171966-192171988 AAGTAGCTGAGGAGGGAAGAAGG - Intronic
944819020 2:203410169-203410191 AAGTAGTGGTGGAGGTAAGGAGG - Intronic
944832132 2:203543400-203543422 CAGTAGGAGTTAAGGGAAGAGGG + Intergenic
946011117 2:216564330-216564352 AATTAGTAGTAGTGGTATGATGG + Intronic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946698161 2:222383130-222383152 CAGGAGTGGTAGAGGCAAGAAGG - Intergenic
947126150 2:226870429-226870451 AAGTAGGAGCAAAGGGAAGTAGG - Intronic
947199603 2:227602953-227602975 AAGGAGAAGCAGAGGGTAGAGGG - Intergenic
947317372 2:228875625-228875647 AAGTAACAGAAGAGGGAAGTGGG - Intronic
947574699 2:231263552-231263574 ATGTAGTAGTACAGGGAGGTGGG - Intronic
1170223565 20:13966284-13966306 AAGAAGAAGAAGAGGCAAGAAGG - Intronic
1171106946 20:22442703-22442725 AAGTAGTAGGCATGGGAAGAAGG + Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172790003 20:37496550-37496572 AGGTAGCAGTGAAGGGAAGAGGG - Intronic
1173149969 20:40558646-40558668 AAGAAATAATGGAGGGAAGAAGG + Intergenic
1173239388 20:41280338-41280360 CAGTATTTATAGAGGGAAGAGGG + Intronic
1173345923 20:42199820-42199842 AAATAATAGTAGAGTGAAGCAGG + Intronic
1177093542 21:16801186-16801208 TAGTACTAATAGAGGAAAGAAGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177244718 21:18508437-18508459 AAGTAGTATGAGAGGGATCATGG + Intergenic
949666939 3:6349979-6350001 AACCAGAAGTAGAGGGCAGAAGG - Intergenic
950989860 3:17421968-17421990 AAGTAGAAGAGGAGGGAGGAAGG - Intronic
951546363 3:23829974-23829996 AAGAAGGAGTGGAGGGAAGGGGG - Intronic
951586727 3:24222409-24222431 AGGTAGTAGTGGGGAGAAGAGGG + Intronic
951706320 3:25547426-25547448 CAGTAGTGGAAGGGGGAAGATGG - Intronic
951811085 3:26700962-26700984 AAGGAACAGTAGAGGCAAGAAGG - Intronic
953414142 3:42705873-42705895 AAGGAGGAGTAAAGGGAAGGTGG - Intronic
953551634 3:43907973-43907995 AGGGAATGGTAGAGGGAAGAGGG - Intergenic
953903656 3:46857550-46857572 AAGAAGGAGGAAAGGGAAGAGGG + Intergenic
955789344 3:62572335-62572357 AAATAGTGGAAGTGGGAAGAGGG - Intronic
957756322 3:84492774-84492796 AAGTAGAAAAAGAGGGAACATGG + Intergenic
959924069 3:111902571-111902593 AAATAGTAGTAGAGGCAAGTGGG + Intronic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962129120 3:132653696-132653718 AAGTAGTATTAATGGAAAGAAGG - Intronic
963184179 3:142394478-142394500 AAGTTGAAGTAGAGTGAAGGAGG - Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
965052974 3:163675300-163675322 AAGCAGTAGTAAAGGGTAGAGGG - Intergenic
965199746 3:165642469-165642491 AAGAAGGAGCAGAGGCAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
966310935 3:178593021-178593043 AAGTACGAGCAGAGGGAAGGGGG + Intronic
966521900 3:180882344-180882366 AAGAAGAAGGAGACGGAAGAAGG - Intronic
966911110 3:184560871-184560893 AAGTAGGTGTTGGGGGAAGAAGG - Intronic
968425199 4:518661-518683 AAGTAGTGGCTGGGGGAAGATGG + Intronic
970166861 4:13247755-13247777 AAGTAGAAGGAGAAAGAAGATGG - Intergenic
970362588 4:15324604-15324626 AAGTAGTTGTAGGGGGAGGATGG - Intergenic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
971606089 4:28660174-28660196 AAATGCTAGTAGAGGCAAGATGG + Intergenic
971754191 4:30685979-30686001 AAGTAGTGGTATATTGAAGAAGG + Intergenic
971873031 4:32268999-32269021 AAGTAGAAGTAGAGAGGAAAAGG - Intergenic
972619180 4:40730461-40730483 AAGTGGTAGTAGAAGAAAAAGGG + Intergenic
973788125 4:54353508-54353530 AAGTAGTGGTAATGGGAGGAAGG - Intergenic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
974705034 4:65503102-65503124 AGGCACTACTAGAGGGAAGAAGG + Intronic
974710492 4:65587759-65587781 AAAATGTAGTAGCGGGAAGATGG - Intronic
974737820 4:65961567-65961589 AAGTAGAAGTGGAGGGACGATGG + Intergenic
974900133 4:67986687-67986709 AAGCAGCACTAGAAGGAAGAAGG + Intergenic
974911507 4:68127234-68127256 AATTAGTAGTAGGAGAAAGACGG - Intronic
975257091 4:72250157-72250179 AAGTAGAAGAGGAGGAAAGAAGG - Intergenic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975639527 4:76485535-76485557 AAGTAGTAGTAGTGGCAGTATGG + Intronic
976536965 4:86228466-86228488 AAGTAGAAGTATATGGGAGAAGG - Intronic
976794154 4:88913415-88913437 AAGTAGTAGTAGAGGGAAGAGGG + Intronic
977468114 4:97407379-97407401 AAGCAGTAGGAGAAAGAAGAAGG - Intronic
977984289 4:103363568-103363590 AAGAAGTAGCAGGGGGAAGGGGG - Intergenic
978627837 4:110707660-110707682 GAGTAGTAAGAGAGGGTAGAGGG - Intergenic
979200432 4:117971370-117971392 AAGGAGGAAGAGAGGGAAGAAGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981127227 4:141120707-141120729 AAGTAGTAAGTGAGGGAAGTGGG + Intronic
981181425 4:141750422-141750444 AAGTCGAAGGAGAGGGAAAAGGG + Intergenic
981590651 4:146356596-146356618 AAGAAGTAGAGGAGAGAAGATGG - Intronic
981624735 4:146742673-146742695 GAGGAGTAGAAGAGGAAAGAAGG - Intronic
982301435 4:153882758-153882780 AAGCAGTGGTTGAGGGAGGAGGG + Intergenic
983552572 4:169032490-169032512 AAGAAGGAACAGAGGGAAGAAGG - Intergenic
984131424 4:175879729-175879751 AATAATTAGTGGAGGGAAGAAGG - Intronic
986190863 5:5495006-5495028 AAGTAGCTGAAGAGGGCAGAAGG - Intergenic
986221734 5:5774775-5774797 AAGTAGGAGGAGAAGGAGGAGGG - Intergenic
987704393 5:21444679-21444701 AAGTTGTACTAGAGGGGAAAGGG - Intergenic
990013255 5:51025969-51025991 AAGTGGAAGTAGAGTGAAAAAGG + Intergenic
990329074 5:54707662-54707684 AATTAGCAGGGGAGGGAAGATGG - Intergenic
990384593 5:55247463-55247485 AAGGAGTAGTAGTGGGAAGTGGG + Intergenic
990849144 5:60181995-60182017 AGGCATTAGCAGAGGGAAGAAGG + Intronic
990956375 5:61344236-61344258 AAGTGGTATTTGGGGGAAGAAGG - Intronic
991595652 5:68302732-68302754 GTCTAGTAGTAGAGGGGAGAGGG + Intergenic
991980426 5:72224789-72224811 AAGTGAAAGTAGAGGGGAGAGGG - Intronic
992112704 5:73511234-73511256 AAGAAGCAGAAGAGGGAAGAGGG - Intergenic
994292272 5:98042004-98042026 AAGTATCAGGAGATGGAAGATGG + Intergenic
995146482 5:108792840-108792862 AAGTAATAGTACAGGGTACAAGG - Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
996485432 5:124028063-124028085 AAGTAGAAGTTGATGGAAGTGGG - Intergenic
999126370 5:149249190-149249212 AAGGTGTAGTATGGGGAAGAGGG - Intronic
999550495 5:152681457-152681479 AATTAGTAGTAAAGGAAACAAGG + Intergenic
1000194268 5:158942850-158942872 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1001127347 5:169031671-169031693 GAGTAGTAGGAGATGGGAGACGG + Intronic
1001313641 5:170628022-170628044 AAGCAGGAGCAGAAGGAAGAGGG - Intronic
1001737807 5:174021114-174021136 AAGAAGAAGGAGAAGGAAGAAGG + Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003618624 6:7677701-7677723 AAATAGGAGAAGATGGAAGATGG - Intergenic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005275169 6:24209276-24209298 TAGTAGTAATAAAGGGAATATGG - Intronic
1008043659 6:46829660-46829682 AAGGAGGAGGAGAGAGAAGAAGG - Intronic
1008692474 6:53995408-53995430 AACTAGTAGCACAGCGAAGACGG + Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010567259 6:77431384-77431406 AAGTTGCAGAAGAGGAAAGATGG - Intergenic
1010995055 6:82523468-82523490 AGGTGGTAGTAGTGGGAATAGGG + Intergenic
1011371313 6:86639827-86639849 AAGAAGGAGGAGAGAGAAGATGG + Intergenic
1011973521 6:93260844-93260866 AAGAAGGAGTATAGGGAAAAGGG + Intronic
1012330010 6:97973617-97973639 AAGTAGAAGTTGAGGGAGGTTGG + Intergenic
1012729532 6:102864111-102864133 AAGTACTACTAGAGGGGAGAAGG + Intergenic
1014045702 6:116883347-116883369 GAGTGGTAGAAGAGGGAAGAGGG - Intronic
1014165191 6:118216442-118216464 AAGTGGGGGTAGGGGGAAGAAGG - Intronic
1014166966 6:118236214-118236236 AAAGAGAAGGAGAGGGAAGAAGG - Intronic
1014510982 6:122322006-122322028 AAGTAGGAGTAGGAGGAAGAAGG + Intergenic
1014528047 6:122524115-122524137 AAGGAGGAGGAGAAGGAAGAAGG - Intronic
1014696521 6:124628154-124628176 AAGTAGAAGGAGATGTAAGAGGG - Intronic
1014785479 6:125613847-125613869 TAGTAGTGGTAGAGGAAAAATGG - Intergenic
1015018487 6:128443310-128443332 AAGAAGGAGATGAGGGAAGAGGG + Intronic
1015398204 6:132758945-132758967 AAGGAGAAGTAGGGGGAGGATGG - Intronic
1015771115 6:136769594-136769616 AACAAATAGGAGAGGGAAGAGGG + Intronic
1016157003 6:140823194-140823216 ATATATTAATAGAGGGAAGAGGG - Intergenic
1016196054 6:141341826-141341848 AAGTGGTGGTAGGGGGACGAGGG + Intergenic
1016308632 6:142710223-142710245 TAGTAGTTGTAAAGGGGAGATGG - Intergenic
1016527075 6:145013789-145013811 AAGTAAGATTAGAGAGAAGAAGG - Intergenic
1016919577 6:149278726-149278748 AAGGAGAAGTAGAGGAAGGAAGG + Intronic
1017606515 6:156140432-156140454 AAATAATATTAGAGGGAAAAAGG - Intergenic
1018420151 6:163634135-163634157 AAGTTATGGAAGAGGGAAGAAGG + Intergenic
1020011459 7:4807889-4807911 AGGGAGAAGAAGAGGGAAGAGGG - Intronic
1020353698 7:7253547-7253569 AAGCAGCAGTAGAGGTAAGCAGG + Intergenic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1020863867 7:13531367-13531389 AAATATTAGTAGAGAAAAGAAGG - Intergenic
1020961695 7:14812710-14812732 AAGAATTAATAGAGTGAAGAGGG - Intronic
1021157578 7:17230732-17230754 AATTAGGAAAAGAGGGAAGAGGG + Intergenic
1021943044 7:25698526-25698548 AACCAGTAGTAGAGGGAAGAAGG + Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022673877 7:32480365-32480387 GAGTAGTGATAGAGGGATGAGGG + Intergenic
1022817008 7:33923508-33923530 AATTAGTAGTAGTGGGAGTAAGG + Intronic
1023088075 7:36592326-36592348 AGGCTGTAGCAGAGGGAAGATGG + Intronic
1024471109 7:49769573-49769595 AAGTAAGAAGAGAGGGAAGAAGG - Intergenic
1026418105 7:70203867-70203889 ATGTATTTGTAGAGAGAAGAAGG + Intronic
1026451160 7:70530796-70530818 AAGCAGTAGGAGAGGAAAGCAGG - Intronic
1026559081 7:71433129-71433151 AAGTAAAAATAGAGGAAAGATGG + Intronic
1027209335 7:76132281-76132303 AAGCTGTAAGAGAGGGAAGAAGG + Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1027719664 7:81724277-81724299 ATAGAGTTGTAGAGGGAAGAGGG - Intronic
1027893539 7:84009799-84009821 AAGTAGAAGGGGAAGGAAGAAGG + Intronic
1028477297 7:91265727-91265749 AAGTGGTAGTTGAGGTAGGAGGG - Exonic
1028482741 7:91325493-91325515 AAATCATATTAGAGGGAAGAGGG - Intergenic
1029473341 7:100768148-100768170 AGGTAGGAGTTAAGGGAAGACGG + Intronic
1030354072 7:108523815-108523837 AAGTACTAGTGTGGGGAAGAGGG + Intronic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030968502 7:116024140-116024162 TAGTAGTTGTAGAGGTAACATGG - Intronic
1031160530 7:118162056-118162078 AAGCAGTCTTAGAGGAAAGAGGG + Intergenic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032012027 7:128352891-128352913 GAGAAGTAGGAGAAGGAAGAGGG - Intronic
1032631922 7:133662805-133662827 AAGAAGCAGTAGATAGAAGATGG + Intronic
1032904180 7:136345433-136345455 AAGAAGTGGTCGAGGGAAGAAGG - Intergenic
1033084563 7:138330255-138330277 AAGGAGGAATAGAGGGTAGAAGG - Intergenic
1033149219 7:138898664-138898686 AAGTAGTAGTACAGGAATGAGGG + Intronic
1035446050 7:158943914-158943936 AAGTAGAAGTAGAGGAACGTGGG - Intronic
1035916122 8:3625426-3625448 ATGTAGTGGGAGAGGAAAGAGGG - Intronic
1036516510 8:9449396-9449418 AAGTAGTAGTAGTGGGGCAATGG + Intergenic
1037061027 8:14509821-14509843 AAGTGGCAGGAGAGAGAAGAGGG + Intronic
1037601567 8:20400628-20400650 AAGAATAAGTAAAGGGAAGATGG - Intergenic
1038303259 8:26375627-26375649 AAGGATGAGAAGAGGGAAGAAGG - Intergenic
1039674505 8:39646885-39646907 AAGTAGAAGGAGAATGAAGAGGG + Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040576399 8:48655210-48655232 AATTAGTAGCAGAGTGAAGGAGG + Intergenic
1041048832 8:53913616-53913638 AGGCAGTCATAGAGGGAAGAAGG + Intronic
1041435483 8:57835724-57835746 AAGTAGTAATGGAGGAAATAGGG - Intergenic
1041765033 8:61410557-61410579 GAATAGAAGTAGAGCGAAGAAGG - Intronic
1041847473 8:62347324-62347346 AAGTTGCAGTAGAGAGAAAAAGG + Intronic
1041946984 8:63455979-63456001 AAGTAGGACAAAAGGGAAGAAGG - Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042272074 8:66964560-66964582 AAATAATATTAGAGGGAAGGTGG + Intronic
1045262139 8:100585477-100585499 AAGCAGAATTAGAGGGAAAATGG + Intronic
1045393773 8:101740103-101740125 GATTAGGAGTAGAGGGAACAGGG - Intronic
1046970286 8:120215586-120215608 TATTAATAGTAGGGGGAAGATGG + Intronic
1048007613 8:130431953-130431975 AAGGAGGAGGAGGGGGAAGAAGG + Intronic
1048143452 8:131818351-131818373 AAGTAGAAGAAGATGGAAGTCGG - Intergenic
1048513024 8:135079440-135079462 CAGTAGTATTAGAGGGTAAAGGG + Intergenic
1048557750 8:135497096-135497118 AAGGAGTAAGAGAGGGAAGTTGG + Intronic
1049122057 8:140747735-140747757 AAGTAGGAGGAGGGGGAGGAAGG + Intronic
1049224530 8:141443515-141443537 AGGTAATGGGAGAGGGAAGAGGG - Intergenic
1050690427 9:8221405-8221427 AGGAAGTAGAAGAGGGAAGGTGG - Intergenic
1051044373 9:12855790-12855812 AAGTATTACTACAGGGAAGCAGG + Intergenic
1051417980 9:16862756-16862778 GAGTAGTAGAAGAGAAAAGAGGG - Intronic
1052065319 9:24011308-24011330 AAATAGTCAGAGAGGGAAGACGG - Intergenic
1052197733 9:25737889-25737911 AGGTAGTAGAAGAGTGAAAAGGG - Intergenic
1054408031 9:64778908-64778930 AAGTAGGAGGAGGAGGAAGAGGG + Intergenic
1055722240 9:79188292-79188314 AAGGAGAAAGAGAGGGAAGAGGG - Intergenic
1055726896 9:79240184-79240206 AACTTTTAGTAGAAGGAAGAAGG + Intergenic
1055869522 9:80857468-80857490 AAGTAGTAGTGAAGGAAAAATGG + Intergenic
1057503831 9:95616661-95616683 AAGTTGTAGGAGAGGTGAGAGGG - Intergenic
1058904412 9:109470028-109470050 AAAAAAAAGTAGAGGGAAGAAGG - Intronic
1059743039 9:117171681-117171703 AGGCAGTAGGAGAGAGAAGAAGG - Intronic
1059836176 9:118156283-118156305 AAGAAGCAGTATATGGAAGATGG - Intergenic
1060980196 9:127787156-127787178 AAGTTGTACTAGAGCTAAGATGG - Intronic
1185688228 X:1948141-1948163 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1185688517 X:2133680-2133702 AAGTGGTAGGAGAGGGTAGAAGG + Intergenic
1186173633 X:6902894-6902916 AAGTAGGAGGAGGGGGAAAAAGG + Intergenic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1188047360 X:25441721-25441743 AAGTAGGAATAGAGGGGAGGAGG + Intergenic
1188705634 X:33326115-33326137 TAGTAATATTAGAGGGAAGAAGG + Intronic
1188740899 X:33780075-33780097 AAGTAGCAGTAGAGGATAGAAGG + Intergenic
1188927612 X:36064662-36064684 AAGTACTAGTAGATGATAGATGG + Intronic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1190230225 X:48576086-48576108 AAGTAGTAGCAAGGGGAACATGG + Intronic
1190416718 X:50187422-50187444 AAGTAGAAATATAGGAAAGAGGG - Intergenic
1191674614 X:63781817-63781839 AAGAATTAGTACATGGAAGAAGG - Intronic
1191775229 X:64806784-64806806 GAGTAGTAGAAGAGGTCAGAGGG + Intergenic
1192163210 X:68804106-68804128 AAGTATAAGAAGGGGGAAGATGG - Intergenic
1192182403 X:68924421-68924443 AAGTAGGAGGAGAGGGAAGGAGG - Intergenic
1192746427 X:73943388-73943410 AAATAAAAGAAGAGGGAAGATGG + Intergenic
1192823616 X:74670559-74670581 AACTTGTAGTAGAGGAAAGGGGG + Intergenic
1193102974 X:77636788-77636810 AAGAAGAAGGAGAAGGAAGAAGG + Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1193478949 X:82002965-82002987 AAGTAGTAGGAGGAGAAAGATGG - Intergenic
1193797637 X:85896045-85896067 AAGTGATAGTAGAGGGTTGAGGG - Intronic
1193819015 X:86139424-86139446 TAGTAGTAGAAAAGGGAAGAGGG - Intergenic
1194128446 X:90049113-90049135 ATGTAGGTGTAGATGGAAGAGGG - Intergenic
1194184227 X:90752762-90752784 AAGTAGTAGTAGAAAGTGGAGGG + Intergenic
1194966440 X:100293748-100293770 AAGTATTTGGATAGGGAAGAAGG + Exonic
1196071452 X:111527671-111527693 AAATAGTAGTTGGGGGATGAGGG + Intergenic
1196348408 X:114696325-114696347 AAGTAGAGGTGGAAGGAAGAAGG - Intronic
1197836189 X:130696257-130696279 AAAAAGGAGTTGAGGGAAGATGG - Intronic
1198328424 X:135597358-135597380 AAGCAGTAGGAGAGGAATGATGG - Intergenic
1198714083 X:139537801-139537823 AAGTAGCAGAGGAGGCAAGAAGG - Intronic
1198834714 X:140792362-140792384 AAGTAGTAATTAAGGGAAAAGGG - Intergenic
1199316543 X:146385336-146385358 AAGTAGGAATAGAGAGAAGATGG + Intergenic
1199680591 X:150221823-150221845 AAACTGTAGTAGAGGGAAGTGGG - Intergenic
1200414210 Y:2890861-2890883 AAGAAGGAGGAGAAGGAAGAGGG + Intronic
1201888817 Y:18919175-18919197 AAGGTGTAGAAGAAGGAAGAAGG + Intergenic