ID: 976794400

View in Genome Browser
Species Human (GRCh38)
Location 4:88916139-88916161
Sequence CAGATATAGCACCTTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 260}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976794395_976794400 2 Left 976794395 4:88916114-88916136 CCACCTAGAGCAAGAAGGCCCTC 0: 1
1: 0
2: 0
3: 19
4: 131
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794393_976794400 8 Left 976794393 4:88916108-88916130 CCTGTACCACCTAGAGCAAGAAG 0: 1
1: 0
2: 1
3: 6
4: 116
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794391_976794400 24 Left 976794391 4:88916092-88916114 CCTAACTATGTGATGCCCTGTAC 0: 1
1: 0
2: 14
3: 90
4: 232
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794389_976794400 26 Left 976794389 4:88916090-88916112 CCCCTAACTATGTGATGCCCTGT 0: 1
1: 1
2: 33
3: 159
4: 299
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794388_976794400 27 Left 976794388 4:88916089-88916111 CCCCCTAACTATGTGATGCCCTG 0: 1
1: 2
2: 48
3: 139
4: 313
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794396_976794400 -1 Left 976794396 4:88916117-88916139 CCTAGAGCAAGAAGGCCCTCACC 0: 1
1: 9
2: 140
3: 258
4: 412
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794390_976794400 25 Left 976794390 4:88916091-88916113 CCCTAACTATGTGATGCCCTGTA 0: 1
1: 0
2: 11
3: 94
4: 269
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260
976794392_976794400 9 Left 976794392 4:88916107-88916129 CCCTGTACCACCTAGAGCAAGAA 0: 1
1: 0
2: 1
3: 6
4: 130
Right 976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG 0: 1
1: 0
2: 4
3: 36
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976794400 Original CRISPR CAGATATAGCACCTTGAGCT TGG Intronic
900265864 1:1756915-1756937 CAGATGTGGCCCCTTGATCTCGG + Intronic
901348448 1:8568655-8568677 CAGATGCAGCCCCTTGACCTGGG + Intronic
903016322 1:20364433-20364455 CAGATGTACCCCCTTGACCTTGG + Intergenic
904444146 1:30554138-30554160 CAGATGCAGCCCCTTGATCTTGG - Intergenic
904605035 1:31693358-31693380 CAAATATAGCATCTTGGGGTGGG - Intronic
906024654 1:42663364-42663386 CAGATCTATCACTTAGAGCTGGG - Intronic
906811473 1:48831328-48831350 CAGATATGGAACCTTGTTCTGGG - Intronic
908264734 1:62367180-62367202 CAGATGCAGCCCCTTGATCTTGG + Intergenic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
912976039 1:114331156-114331178 CAGATGTGGCCCCTTGATCTTGG - Intergenic
913530477 1:119730746-119730768 CGGATGGAGCCCCTTGAGCTTGG + Intronic
915155616 1:153873598-153873620 CAGATATGGCCCCTTGACCCTGG + Intronic
915348947 1:155212822-155212844 CAGATGGAGCAGCTGGAGCTGGG + Intronic
915352134 1:155233448-155233470 CAGATGGAGCAGCTGGAGCTGGG + Intergenic
916018467 1:160771924-160771946 CAGATGCAGCCCCTTGATCTTGG + Intergenic
916986917 1:170201624-170201646 TAGATATGGCCCCTTGATCTTGG - Intergenic
918869747 1:189954151-189954173 CAGATATAACACATTGAGAAAGG - Intergenic
919885142 1:201928122-201928144 CAGATACAGGCCCTTGATCTTGG + Intronic
920956488 1:210624273-210624295 CAGATGCAGCCCCTTGACCTTGG + Intronic
921257343 1:213354583-213354605 CAGATGCAGCCCCTTGACCTTGG - Intergenic
922786338 1:228284237-228284259 CAGATGTGGCCCCTTGACCTTGG - Intronic
923316882 1:232789133-232789155 CAGATGTGGCTCCTTGACCTTGG - Intergenic
923812851 1:237339676-237339698 CAGAAATCTCACCTAGAGCTTGG - Intronic
1063515344 10:6689690-6689712 CAGCTCTGGCACCTTGATCTTGG - Intergenic
1065771789 10:29084838-29084860 CAGATATGGCCCCTCGACCTTGG + Intergenic
1067219197 10:44330955-44330977 CAGATGTGGCCCCTTGATCTTGG - Intergenic
1067914041 10:50377157-50377179 CAGATGTAGCTGCCTGAGCTTGG - Intronic
1068924431 10:62520555-62520577 CAGATACAGCCCCTTGACCTGGG + Intronic
1071493225 10:86150877-86150899 CAGATCCAGCACCTTGATCTTGG + Intronic
1071822691 10:89294373-89294395 CAGATGTGGCCCCTTGATCTTGG - Intronic
1072055989 10:91756533-91756555 CAGATGTGGCCCCTTGACCTTGG - Intergenic
1073231826 10:101977864-101977886 CAGATGTAGCCCCTAGAACTTGG + Intronic
1073478573 10:103771183-103771205 GAGATATAGCACCTTGGGTGAGG - Intronic
1073612748 10:104960426-104960448 CAGATGTACCCCCTTGACCTTGG - Intronic
1074136500 10:110631806-110631828 CAGATGCAGCCCCTTGACCTTGG + Intergenic
1074141443 10:110677065-110677087 CAGATGCAGCCCCTTGACCTTGG - Intronic
1076071502 10:127493539-127493561 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1076115538 10:127894846-127894868 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1076186086 10:128450492-128450514 CAGCTTTAGCACCTGGAGCACGG + Intergenic
1076725133 10:132409586-132409608 CAGAGAGAGGACCTTGAGCCTGG - Intronic
1078441185 11:11369947-11369969 CAGATATATCACAGTGATCTAGG - Intronic
1079492638 11:21006371-21006393 CAGATATAGTCCCTTAACCTTGG + Intronic
1083649920 11:64196730-64196752 CAAATTTAGCACCTTGAAATGGG + Intronic
1086434530 11:86768344-86768366 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1086797925 11:91132257-91132279 CAGATTTAGCAGCTTGTGTTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1089777360 11:120847775-120847797 CTGAGTTAGCACCTTTAGCTTGG + Intronic
1089942065 11:122429277-122429299 CAGATGTAGCCCCTTCATCTTGG + Intergenic
1089942363 11:122431756-122431778 CAGATGCAGCCCCTTGATCTTGG + Intergenic
1093196715 12:16138422-16138444 CAGATATAACACCTCAATCTTGG - Intergenic
1096874311 12:54615355-54615377 CACATACAGCCCCATGAGCTGGG + Intergenic
1097104919 12:56616397-56616419 CAGATCCAGCACTTTGTGCTGGG + Intronic
1097313026 12:58141850-58141872 CAGATGCAGCCCCTTGATCTTGG + Intergenic
1097841634 12:64327136-64327158 CAGATACAACTCCTTGACCTTGG + Intronic
1098548622 12:71738764-71738786 CAGACACAGAACCTTGATCTTGG - Intergenic
1100708273 12:97226012-97226034 CAGATATGGCCCCTTGACCTTGG - Intergenic
1100933250 12:99634387-99634409 CAGATGTAGCCCCTTGACCTTGG + Intronic
1101104854 12:101429616-101429638 CAGATATGGTCCCTTGACCTTGG + Intergenic
1101721140 12:107351695-107351717 CAGATGCAGCCCCTTGATCTTGG + Intronic
1105793975 13:23832311-23832333 CAGATACGGCCCCTTGACCTTGG + Intronic
1107094643 13:36522323-36522345 CAGATGCAGCCCCTTGATCTTGG - Intergenic
1110299635 13:73910996-73911018 CAGATGTGGCCCCTTGACCTTGG + Intronic
1110488107 13:76070177-76070199 CAGAGATAGCACCTTGTTCCAGG + Intergenic
1111889109 13:94059657-94059679 CAAATCTAGCACCTTGATCTTGG - Intronic
1113260148 13:108552813-108552835 CAGATGCATCACCTTGACCTTGG - Intergenic
1117002819 14:51388918-51388940 CAGATGTAGCCCCTTGACCTTGG - Intergenic
1117936724 14:60915054-60915076 CTGAAATAGCACCTTGCTCTCGG - Intronic
1119503286 14:75149403-75149425 CAGATGTGGCCCCTTGATCTTGG + Intronic
1121922316 14:97893661-97893683 CAGATACAGGACCTGGAGCCAGG + Intergenic
1124721977 15:32118238-32118260 CAGATGCAGCTCCTTGACCTCGG + Intronic
1125449859 15:39796880-39796902 GAGATACAGCACCTGGAGCAGGG - Intergenic
1125548650 15:40527804-40527826 CAGATACAGCCCCTTGACCTTGG + Intergenic
1125909685 15:43425108-43425130 CAGATGTAGCCCCTTGACCTTGG + Intronic
1128836625 15:70814045-70814067 CAGATGTGGCAACTTGATCTTGG - Intergenic
1129069927 15:72942287-72942309 CAGACACAGCCCCTTGATCTTGG - Intergenic
1130505539 15:84537191-84537213 CAGAAATAGAACCTTTGGCTGGG - Intergenic
1130850617 15:87790244-87790266 CTGATATAGCAGCTTGATGTAGG + Intergenic
1131468854 15:92678150-92678172 CAGATGTGGCTCCTTGACCTTGG - Intronic
1134264467 16:12681387-12681409 CAGATACAGCCCCTTGACCTTGG + Intronic
1134275836 16:12775239-12775261 CTGATGTAGCCCCTTGACCTTGG + Intronic
1134375928 16:13673173-13673195 CAAAGATAGCACTTTGATCTTGG + Intergenic
1138131915 16:54487180-54487202 CAGCAATAGCACATTGAGTTGGG - Intergenic
1140541830 16:75762686-75762708 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1143695318 17:8610746-8610768 CAGATGCAGCCCCTTGACCTTGG + Intronic
1144446858 17:15339243-15339265 CAGATGTAGCCCCTGGATCTTGG + Intronic
1146548524 17:33759968-33759990 CAGATGTAGCCCCTTGACCTTGG + Intronic
1147941110 17:44048827-44048849 TATATATAGCACCTTGATGTGGG + Intronic
1148828918 17:50416420-50416442 CAGATATAGCAGAGAGAGCTTGG + Intergenic
1149141444 17:53437170-53437192 CAGTTCTGGCACCTTGAGATTGG + Intergenic
1150288247 17:63966161-63966183 CAGCTATGACACCTTCAGCTGGG - Exonic
1150515907 17:65809017-65809039 CAGATGTAGCACCTTGATCTTGG + Intronic
1150990638 17:70254367-70254389 CAAAATAAGCACCTTGAGCTAGG + Intergenic
1151032691 17:70759411-70759433 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1154170924 18:12049426-12049448 TAGATTTAGAACCCTGAGCTGGG - Intergenic
1155902534 18:31409048-31409070 CAGCTATAGGACCTGGAGATAGG - Intronic
1156268785 18:35512434-35512456 TAGTTATAGGACATTGAGCTTGG - Intergenic
1157664549 18:49474872-49474894 CAGATGCAGCCCCTTGACCTGGG - Intergenic
1159567904 18:70075679-70075701 CAGTTATAGCAGCCTGACCTAGG + Intronic
1159712411 18:71777739-71777761 CAAGTATAGCACCATGCGCTAGG - Intronic
1160351640 18:78187301-78187323 CAGATGTGGCCCCTTGACCTTGG - Intergenic
1161168532 19:2801687-2801709 CAGATATGGCCCCTCGACCTGGG - Intronic
1164415258 19:28041780-28041802 CAGATGCAGCCCCTTGATCTTGG + Intergenic
1164519803 19:28970225-28970247 CAGATGCAGCCCCTTGATCTCGG + Intergenic
1164905691 19:31965984-31966006 CAAAAATAGCAATTTGAGCTTGG - Intergenic
1166655272 19:44606576-44606598 CAAATATATCTCCCTGAGCTAGG - Intergenic
1167440610 19:49506666-49506688 CAGATAAAGAACCTTTGGCTGGG + Intergenic
1167537663 19:50065383-50065405 CAGTAATAGCACCTTGAGCTAGG + Intergenic
925488179 2:4360491-4360513 CAGCTATATGACCTTGAGCAAGG + Intergenic
926566118 2:14476233-14476255 CAGATGCAGCTCCTTGATCTTGG + Intergenic
926848553 2:17169334-17169356 CACACAGAGCACTTTGAGCTTGG + Intergenic
927231253 2:20826256-20826278 CAGGTATAGCCCCTCGACCTGGG - Intergenic
927427543 2:22997438-22997460 CAGATGTAGCCCCTTGACCTTGG + Intergenic
927732606 2:25487866-25487888 CAGATCTCTCACCTTGTGCTAGG - Intronic
927845453 2:26469914-26469936 CAGTCAGAGCACCCTGAGCTAGG + Intronic
928070268 2:28208243-28208265 CAGACACAACATCTTGAGCTGGG - Intronic
928421884 2:31143526-31143548 CAGATATTGCACATTGAGCAGGG + Intronic
928822648 2:35380384-35380406 CAGATGCAGCCCCTTGATCTTGG + Intergenic
930256717 2:49101805-49101827 CAGATGTGGCCCCTTGACCTTGG - Intronic
930363203 2:50407767-50407789 CAGATATGGTTCCTTGACCTTGG + Intronic
930716189 2:54596125-54596147 CAGTCACAGCAGCTTGAGCTTGG + Intronic
931000559 2:57776110-57776132 CAAATATAGCAACTTGAACAGGG - Intergenic
931444202 2:62313322-62313344 CAGCTATAGCTACTTGAGGTGGG + Intergenic
932284190 2:70518752-70518774 CAGCTATAGTGCCTGGAGCTGGG + Intronic
932356592 2:71072769-71072791 CAGATCCAGGACCTGGAGCTGGG - Intronic
935051114 2:99525884-99525906 CAGATATGGCCCCTCGATCTTGG - Intergenic
936027778 2:109046745-109046767 CAGACATAGCACCGTGCCCTTGG + Intergenic
936438949 2:112533556-112533578 CAGATATAGCCCCTTGATATTGG - Exonic
936481544 2:112889628-112889650 CAGATGCAGCTCCTTGATCTTGG - Intergenic
936610070 2:113993711-113993733 CAGATGTGGCCCCTTGAACTTGG - Intergenic
937344118 2:121112835-121112857 CAAATCTAGCTCCCTGAGCTGGG - Intergenic
939092518 2:137795730-137795752 CAGACATAGGACCTAGAGCATGG + Intergenic
941282480 2:163570653-163570675 CAAATCCAGCACCTTGATCTTGG + Intergenic
941850977 2:170179657-170179679 CAGATGTGGCCCCTTGATCTTGG + Intronic
943636120 2:190308648-190308670 CAGATGCAACACCTTGACCTTGG + Intronic
944430696 2:199630288-199630310 CAGATATGGCCCCTTGATCTTGG + Intergenic
944636427 2:201679962-201679984 CAGCTATATCACCTTCTGCTGGG - Intronic
944888411 2:204089425-204089447 CAGATGCAGCTCCTTGATCTTGG + Intergenic
945853379 2:215036941-215036963 GAAATATAATACCTTGAGCTGGG + Exonic
946144619 2:217719939-217719961 CAGATGTGGCTCCTTGACCTTGG - Intronic
946444772 2:219728789-219728811 TTGATAGAGCACCTTGACCTGGG + Intergenic
947944042 2:234084274-234084296 AAGATGTAGAAACTTGAGCTGGG - Intergenic
948551365 2:238775049-238775071 GAGATGCAGCACCTTGAGATGGG - Intergenic
948967162 2:241391797-241391819 CAGCTTTAACATCTTGAGCTTGG - Intronic
1169616915 20:7458073-7458095 CACATGCAGCACCTTGATCTTGG + Intergenic
1169852558 20:10068469-10068491 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1171471706 20:25377446-25377468 CAGATATGGCCCCTTGACCTTGG - Intronic
1173108449 20:40161209-40161231 CAAATATATCACAGTGAGCTGGG + Intergenic
1173881602 20:46417256-46417278 CAGATAAAGCACTTTCAGATAGG + Intronic
1174119345 20:48250570-48250592 CAGACACAGCACCTTGACCTTGG + Intergenic
1174526428 20:51175724-51175746 CAGATTCAGCACATTGAGCAAGG + Intergenic
1175954761 20:62603611-62603633 CTGCTATGGCACCTCGAGCTGGG + Intergenic
1178298997 21:31435919-31435941 CAGATGCAGCCCCTTGATCTTGG + Intronic
1178348377 21:31851518-31851540 CAGATATGGCCCCCTGATCTTGG - Intergenic
1178603079 21:34011959-34011981 CACATTTAGCACCTAGATCTTGG - Intergenic
1178760118 21:35394058-35394080 CAGATGTGGCCCCTTGACCTTGG + Intronic
1178846450 21:36177798-36177820 CAGATGCAGCCCCTTGAGCTTGG + Intronic
1179157796 21:38864983-38865005 CAGATGCAGCCCCTTGACCTTGG + Intergenic
1179370589 21:40802781-40802803 CAGATGTGGCCCCTTGACCTTGG + Intronic
1181661720 22:24355309-24355331 CACATTTAGCACCTGGATCTTGG - Intronic
1182089910 22:27587329-27587351 CAGATGTAGCTCCTTGATCTTGG - Intergenic
1182576983 22:31279505-31279527 GAGAGATAGCTCCCTGAGCTGGG + Intronic
1182939202 22:34258296-34258318 CAGATATAGTCCCTTGACCTTGG + Intergenic
1182951027 22:34375998-34376020 CAGATGTGGCCCCTTGACCTTGG - Intergenic
1184183404 22:42846932-42846954 CAGATGTAGCCCCTTGACCTTGG - Intronic
1184394102 22:44222497-44222519 CAGATGTAGTGCCTTGACCTTGG - Intergenic
1185105280 22:48865784-48865806 AAGAAATAGCAGCTAGAGCTTGG - Intergenic
949491779 3:4596148-4596170 CATAGATAGCAACTTAAGCTCGG - Intronic
950319549 3:12037476-12037498 CAGATACAGCCCCTTGATCTTGG - Intronic
950555565 3:13693806-13693828 CAGATGCAGCCCCTTGACCTCGG - Intergenic
951613418 3:24517699-24517721 CAGATACAGCCCCTTGATCCTGG + Intergenic
953147936 3:40295821-40295843 CAGATGTGGCCCCTTGACCTTGG + Intergenic
955026913 3:55176601-55176623 CAGATAAGGCCCCTTGATCTTGG - Intergenic
955296364 3:57738891-57738913 CAGGTATAGCACTTGGTGCTGGG + Intergenic
955735801 3:62037128-62037150 CAGATTTGGAACCTGGAGCTAGG + Intronic
955792859 3:62606511-62606533 CAGATTCAGCCCCTTGACCTTGG + Intronic
956234094 3:67048079-67048101 AAGATATAGCACCTTAACTTAGG + Intergenic
956287065 3:67621766-67621788 CAGATACAGCCCTTTGACCTTGG + Intronic
957192022 3:77021883-77021905 CAGATGAAGCCCCTTGATCTTGG + Intronic
958456380 3:94336873-94336895 CAGATGCAGCCCCTTGATCTTGG - Intergenic
958634294 3:96723270-96723292 CAGATATCAAACCTAGAGCTTGG + Intergenic
959408236 3:105987969-105987991 CAGCTATAGCGCCTTGAACGTGG + Intergenic
960704781 3:120471479-120471501 CAGATATAGCAACATCACCTGGG - Intergenic
961068370 3:123896312-123896334 CAGATGAAGCCCCTTGACCTTGG + Intergenic
962204603 3:133424531-133424553 CAGATAAAGCAGCTGGAGGTGGG - Intronic
962236783 3:133713728-133713750 CAGGTATGGCTCCTTGAGCAAGG + Intergenic
962390512 3:134967648-134967670 CAGATGTAGCACCTTGACCTTGG + Intronic
962908479 3:139826230-139826252 CAGATGTGGCCCCTTGACCTTGG + Intergenic
963137803 3:141923460-141923482 CAGATGCAGCTCCTTGATCTTGG + Intronic
966039044 3:175458020-175458042 CAGTAATAGCAACTTCAGCTGGG + Intronic
966417382 3:179703478-179703500 GAGACATAGCACTGTGAGCTCGG + Intronic
968557403 4:1253357-1253379 CAGATGCAGCCCCTTGAGGTTGG - Intergenic
971551662 4:27965234-27965256 CATATAAAGCAACTTGACCTGGG - Intergenic
974467886 4:62280753-62280775 CAAATACAGCCCCTTGACCTTGG + Intergenic
976248787 4:83029695-83029717 CAGATATGGCTCCTTTACCTTGG + Intergenic
976794400 4:88916139-88916161 CAGATATAGCACCTTGAGCTTGG + Intronic
976832023 4:89326275-89326297 CAAATATAGCAACTTGAACAGGG - Intergenic
977722138 4:100251553-100251575 CAGATACAGCCCCTTGACCTTGG + Intergenic
978264331 4:106804460-106804482 CAGATATAGCAATTAGAACTGGG + Intergenic
979103147 4:116648635-116648657 GTGATATACCAACTTGAGCTGGG + Intergenic
979550694 4:121987804-121987826 CAGATGTGGCTCCTTGACCTTGG + Intergenic
980142334 4:128934384-128934406 CAGATATTGCTCCATGTGCTAGG + Intronic
981361010 4:143845697-143845719 CAGATATGGCCCCTCGACCTTGG - Intergenic
981371748 4:143966699-143966721 CAGATATGGCCCCTCGACCTTGG - Intergenic
982333950 4:154213269-154213291 CAGATGTAGCCCCTTGACCTTGG - Intergenic
982368989 4:154612852-154612874 CAGAGAAAAAACCTTGAGCTGGG - Intronic
984510827 4:180676729-180676751 CAGATGTGGCCCCTTGACCTTGG - Intergenic
987957728 5:24762816-24762838 CAGCTATATCATCTTGAACTTGG + Intergenic
988149188 5:27353876-27353898 CAAATCTAGCACCTTGTTCTGGG + Intergenic
988440893 5:31231531-31231553 CAGATATGTCCCCTTGACCTTGG - Intronic
990906732 5:60811760-60811782 CAGATGTAGCCCCTTGGCCTTGG + Intronic
992475584 5:77098725-77098747 CAGATGCAGCTCCTTGATCTCGG - Intergenic
992852804 5:80828155-80828177 CAGATGTAGCCCCTTGACCTCGG - Intronic
993310820 5:86330046-86330068 CAGATGTAGCCCCTTAACCTTGG + Intergenic
993797871 5:92291704-92291726 CAGATGTAGATCCTTGATCTTGG - Intergenic
994829319 5:104758536-104758558 CATATATGACAACTTGAGCTAGG - Intergenic
995345633 5:111113702-111113724 CAGATATGGCCCTTTGACCTGGG - Intronic
996685327 5:126273729-126273751 CAGATACAGCACTTTGACCTGGG + Intergenic
997411374 5:133693739-133693761 CAGATGCAGCCCCTTGATCTTGG - Intergenic
997842657 5:137256412-137256434 CAGATGCAGCCCCTTGATCTTGG - Intronic
998924508 5:147107013-147107035 CAGATGGAGCCCCTTGATCTTGG + Intergenic
999641796 5:153679966-153679988 TTGATATAACACCTTGAGGTAGG + Intronic
1001065186 5:168530016-168530038 CAGGTACAGCACCTTGGACTTGG - Exonic
1001592514 5:172875350-172875372 CAGACATAACATCTGGAGCTGGG - Intronic
1004247749 6:13996412-13996434 CAAATATAGCACCTTGACCTTGG - Intergenic
1004339982 6:14799403-14799425 CAGGTAAAGCACTTTGGGCTGGG - Intergenic
1004358803 6:14952745-14952767 CAGATGTAGCCCCTTTACCTTGG + Intergenic
1006051407 6:31347674-31347696 CAGATAGAGTCCCTTGATCTGGG + Intronic
1006632769 6:35441362-35441384 CTGCTATAGCACCTTGTCCTTGG + Intergenic
1006658041 6:35613514-35613536 CAGATATAAAACCTGGAACTAGG - Intronic
1007156922 6:39753845-39753867 CAGATAGAGGAGCTTGAGCTGGG - Intergenic
1007526865 6:42503678-42503700 CAGATGTGGCCCCTTGACCTTGG - Intergenic
1011094726 6:83647873-83647895 TAGATACAGCCCCTTGATCTTGG - Intronic
1011409812 6:87056308-87056330 CAGATGCAGCTCCTTGACCTTGG - Intergenic
1014932751 6:127353446-127353468 CAGATAGACCACCCTGACCTTGG - Intergenic
1018372812 6:163184171-163184193 CAAATTTAGCTCCTTGTGCTCGG + Intronic
1018601408 6:165546949-165546971 TACATACAGCACCTAGAGCTTGG + Intronic
1018912521 6:168110806-168110828 CAGATATTGCCCCTTTTGCTGGG - Intergenic
1019874247 7:3794676-3794698 CAGATATAGTCCCTCGACCTTGG + Intronic
1020055458 7:5114786-5114808 TAGAAATAACAGCTTGAGCTTGG + Intergenic
1021149259 7:17129232-17129254 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1021183338 7:17533930-17533952 CAGATATGGCCCCTTGACCTTGG - Intergenic
1023642131 7:42269950-42269972 CAGATGTAGCCCCTTGACCTTGG - Intergenic
1024171625 7:46793698-46793720 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1024240612 7:47432410-47432432 CAGACGCAGCCCCTTGAGCTTGG + Intronic
1026103650 7:67403393-67403415 CAGATGCAGCCCCTTGATCTTGG - Intergenic
1026241094 7:68575830-68575852 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1026405811 7:70064378-70064400 CAGAAATAGCACCTTTAACTGGG + Intronic
1029513968 7:101014374-101014396 CAGATGCAGCCCCTTGATCTTGG - Intronic
1030175122 7:106644504-106644526 CAGATGCAGCCCCTTGATCTTGG + Intergenic
1030914322 7:115294009-115294031 TAGATTCAGCACCTTGACCTTGG - Intergenic
1031492467 7:122405947-122405969 TAGATATAGCACCTAGAGTTTGG + Intronic
1032473221 7:132193329-132193351 CAGATGTAGCCCCTAGATCTTGG + Intronic
1032633996 7:133686188-133686210 CAGATGTAGCCCCTTGACCTTGG + Intronic
1033093356 7:138407127-138407149 CAGGAAAAGCACCCTGAGCTTGG + Intergenic
1034512776 7:151549848-151549870 CAGATATGGCCCCTTGATTTTGG + Intergenic
1035106688 7:156446936-156446958 CAGATGTGGCCCCTTGACCTGGG - Intergenic
1035978005 8:4334872-4334894 CTGATCTATCACCTTGATCTTGG - Intronic
1038821078 8:30952377-30952399 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1039252282 8:35679871-35679893 CAGACATAGCTCCTCGACCTTGG - Intronic
1042125985 8:65537499-65537521 CAGATGTAGCCCCTTGACCTTGG + Intergenic
1042131131 8:65587632-65587654 CAGATACAGCTTCTTGACCTTGG - Intergenic
1042203337 8:66303359-66303381 CAGATGTAGCCCCTCGATCTTGG + Intergenic
1042352891 8:67795640-67795662 CAGATAGAGCAGCTAGAACTTGG + Intergenic
1042677978 8:71343621-71343643 CAGATACAGGCCCTTGACCTTGG + Intronic
1043288624 8:78568048-78568070 CAAATATAGCACCCAGATCTTGG - Intronic
1043688843 8:83124975-83124997 CAGATATAACGCCTTGATCTAGG - Intergenic
1043811739 8:84750820-84750842 CAGATGTGGCCCCTTGACCTTGG + Intronic
1044407500 8:91845687-91845709 CAGGTATAGCACCTGGTGCACGG - Intergenic
1045210463 8:100092644-100092666 CAGATGCAGCCCCTTGATCTTGG + Intronic
1046663359 8:116973157-116973179 CAGATGTGGTACCTTGATCTTGG + Intronic
1046801555 8:118434158-118434180 GAGATGTAGCACCTTGAAATTGG - Intronic
1048030115 8:130623221-130623243 CACATCTAGCACCTAGATCTTGG - Intergenic
1048470756 8:134702138-134702160 CAGATGCAGCCCCTTGACCTTGG + Intronic
1049010359 8:139883270-139883292 CAGACATAGCTCCTTGACCTGGG + Intronic
1050602269 9:7265048-7265070 CAGATGCAGCCCCTTGACCTTGG + Intergenic
1051131784 9:13870377-13870399 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1051668068 9:19483991-19484013 CAGATGCAGCCCCTTGACCTTGG + Intergenic
1052171198 9:25399352-25399374 CAGATATAGCTCCTCGATCTTGG - Intergenic
1053459233 9:38255764-38255786 CAGATGTGGCCCCTTGATCTTGG - Intergenic
1055129504 9:72758709-72758731 CACATACAGGTCCTTGAGCTTGG - Intronic
1055140439 9:72871175-72871197 CAGATGTGGCCCCTTGACCTTGG - Intergenic
1055179668 9:73369338-73369360 TAGTTATCTCACCTTGAGCTTGG + Intergenic
1056256631 9:84805927-84805949 AAGATACAGCCCCTTGACCTTGG + Intronic
1061619484 9:131802362-131802384 CAGATGCAGCCCCTTGACCTTGG - Intergenic
1187286133 X:17905562-17905584 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1187337937 X:18397003-18397025 CAGATGTAACCCCTTGACCTTGG - Intergenic
1188248686 X:27864436-27864458 CAGATATACCTCCTTGGGCAAGG - Intergenic
1189491457 X:41474286-41474308 CAGGTAGAGCAGCTCGAGCTCGG - Exonic
1190135636 X:47794952-47794974 CAGATGTGGCCCCTTGACCTTGG + Intergenic
1192658688 X:73020417-73020439 CAGATGTGGCCCCTCGAGCTTGG + Intergenic
1192667678 X:73105020-73105042 CAGATATGGCTCCTTGACCTTGG - Intergenic
1192990409 X:76447771-76447793 CAGACATAGCTCCTCGACCTTGG + Intergenic
1196799977 X:119533682-119533704 CAGATATTGCACTAGGAGCTGGG - Intergenic
1199505552 X:148557448-148557470 CAGATGCAGCTCCTTGATCTTGG - Intronic
1199938846 X:152604466-152604488 CAGATGTGGCCCCTTGATCTTGG - Intergenic
1200036576 X:153334971-153334993 CAGACAGAGGGCCTTGAGCTCGG - Intronic
1200417375 Y:2926422-2926444 CAAATATACCTCCTTGAACTTGG + Intronic
1201465411 Y:14275136-14275158 CAGAGATAGCACCTGTTGCTGGG - Intergenic
1201566118 Y:15366892-15366914 CAGATTTATCACCTGGTGCTGGG - Intergenic
1202364417 Y:24147435-24147457 CAGAAATAGAACCTTTGGCTGGG + Intergenic
1202506364 Y:25522687-25522709 CAGAAATAGAACCTTTGGCTGGG - Intergenic