ID: 976794495

View in Genome Browser
Species Human (GRCh38)
Location 4:88917333-88917355
Sequence ACTCACTCACTTCCAAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 3, 2: 17, 3: 59, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976794488_976794495 25 Left 976794488 4:88917285-88917307 CCAGGCTCTTTTTAATAACCAGC 0: 8
1: 158
2: 465
3: 746
4: 1019
Right 976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG 0: 1
1: 3
2: 17
3: 59
4: 358
976794489_976794495 7 Left 976794489 4:88917303-88917325 CCAGCTCTTGCAGAAACTAATAC 0: 1
1: 1
2: 17
3: 93
4: 337
Right 976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG 0: 1
1: 3
2: 17
3: 59
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976794495 Original CRISPR ACTCACTCACTTCCAAGGGA GGG Intronic
901834732 1:11916754-11916776 ACTCACTCACTCCTGAGAGAAGG + Intergenic
902161041 1:14530545-14530567 ACTCACTCATTACCATGGGGAGG - Intergenic
902541473 1:17158630-17158652 ACTCACTCACCTCCAAGGGAGGG - Intergenic
903206235 1:21784426-21784448 CCTAACCCACTTCCAAGGGCAGG - Intergenic
904514292 1:31041574-31041596 ACTCACTCATTACCATGGGGAGG - Intronic
904818853 1:33227274-33227296 GCCCACTCAATTCCAGGGGATGG - Intergenic
905622217 1:39458076-39458098 ACTCACTCATTACCATGGGGAGG + Intronic
906042447 1:42798546-42798568 TCTCACTCCTTTCCAAGGGATGG - Intergenic
906778875 1:48554532-48554554 AATCACACACTTCCTAGGCATGG - Intronic
907829694 1:58053073-58053095 ACTTACTCACTTCCAAAAAATGG + Intronic
908499687 1:64730666-64730688 ACTCACTCACCCTCAAGGGAGGG + Intergenic
910002137 1:82353935-82353957 ACTCACTCAACTCCATGGGAGGG + Intergenic
910077192 1:83295517-83295539 ATTGACTCACTTCTAAGGAATGG + Intergenic
910470945 1:87552208-87552230 ACTCACTCACTACCTGGAGAAGG + Intergenic
910552629 1:88493746-88493768 TCCCACTCACTTTCAAGGGAAGG + Intergenic
911498355 1:98657739-98657761 ACTCACTCACTACCACAGGGAGG + Intergenic
911523160 1:98952459-98952481 ACTCACTCACTTCCAACTAAAGG + Intronic
911841544 1:102688499-102688521 ACTGAGTCACTTCCTAGGGGAGG - Intergenic
912211283 1:107559939-107559961 ACTCACTCACCACCAAGGAAGGG + Intergenic
912717821 1:111994376-111994398 ACTCACTCATTACCATGGGGAGG - Intergenic
914465213 1:147922184-147922206 CCTCACTCCCCTCCAAGTGAGGG + Intergenic
915585449 1:156841572-156841594 ACTCAGTGCATTCCAAGGGATGG + Intronic
916884921 1:169058037-169058059 ACTCACTCGCCTCCTAAGGAGGG - Intergenic
917265075 1:173212172-173212194 ACTCACTCACCCCAAAAGGAGGG + Intergenic
917806771 1:178620903-178620925 ACTCACTCATTACCATGGGGAGG + Intergenic
919950793 1:202361479-202361501 ACTCACTCATTGCCATGGAAAGG + Intronic
920460772 1:206138313-206138335 ACTCACTCATTGCCATGGGGAGG + Intergenic
921283200 1:213586993-213587015 GGTGACTCACTTCCAAGTGAGGG + Intergenic
922567425 1:226610110-226610132 TGTCACTCACACCCAAGGGAAGG + Intergenic
922862273 1:228829732-228829754 ACTCACTCGCCTTGAAGGGAGGG + Intergenic
923807170 1:237270011-237270033 ACTTTCTCACTTCAAAGTGATGG - Intronic
924446024 1:244132253-244132275 ACTCACTCATTACCATGGGGAGG + Intergenic
924619098 1:245645078-245645100 ACTCACTCATTACCATGGGAAGG + Intronic
1062954229 10:1529675-1529697 ACTCAGTAGCTTCCACGGGAGGG + Intronic
1063557423 10:7093982-7094004 ACTCAATCACCCCTAAGGGAGGG - Intergenic
1064968631 10:21040566-21040588 ACTCACTCATTACCATGGGGAGG + Intronic
1065738541 10:28775788-28775810 ACTCACTCACTGTCATGAGAAGG + Intergenic
1065972449 10:30816322-30816344 ACTCACTCATTACCGTGGGAGGG + Intergenic
1066462466 10:35623966-35623988 ACTCACTCACTACCATGGAAGGG + Intergenic
1067234347 10:44435720-44435742 TCTCTCTCACTGCTAAGGGAAGG - Intergenic
1067684341 10:48457884-48457906 CCTCACCCACTTCCAACAGAGGG - Intronic
1068215704 10:53979338-53979360 ACTCACTCACTATCATGAGAAGG + Intronic
1068372591 10:56137319-56137341 ACTCACTTACTTCTGAGAGAGGG - Intergenic
1068491332 10:57728215-57728237 ACTCATTCACCTCCAAGGGAAGG - Intergenic
1068887702 10:62114633-62114655 ACTCACTCACCCCCATAGGAGGG + Intergenic
1069168625 10:65196618-65196640 ACTCATTTACTTCCAAGTGCAGG - Intergenic
1069628303 10:69881490-69881512 GCTAACTTACATCCAAGGGAGGG + Intronic
1069694189 10:70374707-70374729 TCTCACTGCCTTCCAATGGAGGG - Intronic
1070716279 10:78724410-78724432 ACTCACACATTACCATGGGAGGG + Intergenic
1071379103 10:85039955-85039977 ACTCACTCATTACCAAGGGGAGG + Intergenic
1071490908 10:86135681-86135703 ACCCACTCACTGCCAAGGCCAGG + Intronic
1073084092 10:100877309-100877331 ACTCAATCACGGCCCAGGGAAGG + Intergenic
1073522652 10:104148549-104148571 ACTCACTCACCCCTGAGGGAGGG - Intronic
1074525795 10:114262036-114262058 ACTCACTCATCGCCAATGGATGG + Intronic
1075427596 10:122353878-122353900 ACTCACTCATTACCATGGGGAGG - Intergenic
1076614575 10:131747173-131747195 ACCCACACACTTCCTAGGGATGG + Intergenic
1077082099 11:728758-728780 CCTCCCTCACTTCCAAGGACTGG - Intergenic
1077547795 11:3183371-3183393 ACTCACTCTCTCCCTTGGGAGGG + Intergenic
1080314046 11:30928109-30928131 ATTCACTCATTTCCAAGGGGGGG - Intronic
1080882193 11:36332677-36332699 ACTCACTCATCACCAAGGGAAGG - Intronic
1080894889 11:36440950-36440972 GCTCACTCATTACCAAGGGGAGG + Intronic
1081526385 11:43930459-43930481 ACTCACTCATTACCATGGGGAGG - Intronic
1082779935 11:57279238-57279260 CCTCACACACTTCCAGGGGGTGG + Intergenic
1085938343 11:81177913-81177935 ACTCACACAATTGCAAGGGCTGG - Intergenic
1086401701 11:86466060-86466082 ACTCAGTCATTTTTAAGGGAAGG - Intronic
1086445503 11:86866745-86866767 ACTCACTCACACCCAAGAGAGGG - Intronic
1086897418 11:92329284-92329306 ACTCACTCATCTCGGAGGGAGGG - Intergenic
1087124606 11:94611642-94611664 ACTCACTCATTACCATGGGGAGG - Intronic
1087157821 11:94922076-94922098 GCTCACTCACCTGCAAGGGTTGG - Intergenic
1087790688 11:102403759-102403781 ACTCACTCACTACCACGTGAAGG - Intronic
1087821938 11:102722300-102722322 ACTCACACTCTTCAAAGGCAGGG + Intronic
1088546629 11:110965968-110965990 ACTCACTCATTACCATGGGGAGG + Intergenic
1088951807 11:114579244-114579266 ACTCACTCATTACCATGGGGAGG + Intronic
1090105767 11:123852415-123852437 ACTCCCTCATTACCAAGGGGAGG - Intergenic
1091861567 12:3790008-3790030 ACTCACTCATTACCATGGGGCGG + Intergenic
1093124246 12:15308731-15308753 ACTCACTCATTACCTCGGGAAGG - Intronic
1094030548 12:26007159-26007181 ACTCACTCACCATCAGGGGAGGG + Intronic
1094236077 12:28168148-28168170 ACTCACTCACTCCCTCAGGAAGG - Intronic
1095989619 12:48025631-48025653 AATCACTCAGACCCAAGGGAGGG - Intergenic
1096584523 12:52611161-52611183 CCTTACTCACTCCTAAGGGAGGG - Intronic
1098795431 12:74882363-74882385 ACTCACTTATCACCAAGGGATGG + Intergenic
1099359633 12:81683977-81683999 ACCCACTCACCCCCAAGGGAGGG + Intronic
1099435832 12:82643961-82643983 ACTCACTCATTACCATGGGAAGG + Intergenic
1100213377 12:92421672-92421694 GCCCACTCACATCCAAGGGCAGG - Intronic
1100778271 12:97996088-97996110 ATTCACTCACCCCCAAGGAAGGG - Intergenic
1100795231 12:98175116-98175138 ACACACTCACTTACAAAGGCAGG + Intergenic
1101254530 12:102964550-102964572 ATGCACTCACTTCAAAGGGGAGG + Intergenic
1104588649 12:130067152-130067174 TCTCACTCATCTCCAAGGGTAGG - Intergenic
1104931227 12:132340494-132340516 ACTCACCCACTGCCAAGGGAGGG - Intergenic
1105606002 13:21927060-21927082 ACTCACTCACTCCCGTGGGGAGG + Intergenic
1107114651 13:36733820-36733842 ACTCACTTATCACCAAGGGATGG - Intergenic
1108445188 13:50501569-50501591 ACTCACTCATTACCATGGGGAGG + Intronic
1108770361 13:53693415-53693437 CTTCACTCATTACCAAGGGAAGG - Intergenic
1109158942 13:58948319-58948341 ACTCACTCACTGTCATGAGAAGG - Intergenic
1109485667 13:63016223-63016245 ATTCACTCACTCCAGAGGGAGGG + Intergenic
1111867909 13:93792696-93792718 TCACACTTACTTTCAAGGGAAGG + Intronic
1111924148 13:94445231-94445253 ACTCACCAAGTTTCAAGGGAAGG - Intronic
1111961200 13:94812464-94812486 ACTCACTCATTACCATGGGGAGG - Intergenic
1112234483 13:97623433-97623455 ACTCTGTCACTTCCAGGAGAAGG + Intergenic
1113584479 13:111455305-111455327 ACTCACTCATTACCATGGGAAGG - Intergenic
1114599343 14:23941878-23941900 ACTCACTCATCACCAAGGGGAGG + Intergenic
1114601714 14:23961021-23961043 ACTCACTCACTGCCACAGGGAGG + Intronic
1114823768 14:26052801-26052823 ACTCACTCATCACCAAGAGATGG - Intergenic
1115997649 14:39210733-39210755 ACTTCCTCACTTCCATGTGAGGG + Intergenic
1119814027 14:77549135-77549157 ACTCACTCATTACCCAAGGATGG - Intronic
1121123130 14:91388855-91388877 ACAGATTCCCTTCCAAGGGAAGG + Intronic
1121209525 14:92197670-92197692 CCTCCCTCACTTCTAAGGCACGG - Intergenic
1122386753 14:101353599-101353621 ACTCACTCATCACCAAGGGGAGG - Intergenic
1124193827 15:27603125-27603147 ATTCACTCACTACCATGAGAAGG - Intergenic
1125044686 15:35231898-35231920 ACTCACTCATTACCACGGGTAGG + Intronic
1125402616 15:39320359-39320381 ACTCCCTCACCCCCATGGGAAGG - Intergenic
1126261974 15:46704020-46704042 GCTCATTCACTCCCAAGGGAGGG - Intergenic
1126967046 15:54065858-54065880 ACTTACTGACTTCCAATGAAGGG + Intronic
1127008499 15:54596720-54596742 AATCACTCATTTCCATGGGGAGG - Intronic
1127139926 15:55964874-55964896 ACTCACTCACTTCCGAGGGAGGG - Intronic
1127290959 15:57570639-57570661 ACTCACTCACCCCCAAGAAAGGG - Intergenic
1128067186 15:64772699-64772721 ACTCACCCACATCTCAGGGAAGG + Intronic
1128467465 15:67924966-67924988 ACTCACTCATTACCATGGGGAGG + Intergenic
1129035061 15:72644153-72644175 ACTCACTCATTACCATGGGGAGG + Intergenic
1129061950 15:72867359-72867381 ACTCACTTGTTTCCAAGGGTGGG - Intergenic
1129214821 15:74093063-74093085 ACTCACTCATTACCATGGGGAGG - Intergenic
1129390564 15:75218604-75218626 ACTCACTCATTACCATGGGGAGG + Intergenic
1129473712 15:75769015-75769037 ACTCACTCATTACCATGGGGAGG - Intergenic
1129535454 15:76310858-76310880 ACCCACTCACTGTCAAGGGCGGG - Intronic
1129731954 15:77937414-77937436 ACTCACTCATTACCATGGGGAGG - Intergenic
1130833786 15:87629761-87629783 TCTCAGTCACTTGCAAGGAAAGG + Intergenic
1132113395 15:99118466-99118488 TCTCATTCACATGCAAGGGAAGG + Intronic
1132201674 15:99958849-99958871 AGTCACTCATTTCCAAGAGAAGG + Intergenic
1133448684 16:5885126-5885148 CCTTTCTCACTTCCAAGGTAAGG + Intergenic
1134502539 16:14780481-14780503 ACTCACTCATTACTCAGGGAGGG + Intronic
1134578024 16:15348414-15348436 ACTCACTCATTACTCAGGGAGGG - Intergenic
1134724564 16:16409132-16409154 ACTCACTCATTACTCAGGGAGGG + Intergenic
1134770485 16:16804943-16804965 AGTCTCTCACTTCCCAGGAAAGG + Intergenic
1134942867 16:18302727-18302749 ACTCACTCATTACTCAGGGAGGG - Intergenic
1135202294 16:20448772-20448794 ACTCACTCACTCCCTAGGGAGGG - Intergenic
1135216810 16:20579094-20579116 ACTCACTCACTCCCTAGGGAGGG + Intergenic
1135259326 16:20967246-20967268 ACTCACTCAATTCCATGGTTTGG + Intronic
1135893639 16:26379102-26379124 ACTCACTCATCACCAAGGGGCGG + Intergenic
1137069930 16:35895416-35895438 ACTCACTCACTACCACAGGGAGG - Intergenic
1142306615 16:89289568-89289590 ACTCCCTCACTTCACAGGGCTGG - Intronic
1143356305 17:6331299-6331321 TCTCACTAAATTCCCAGGGAGGG + Intergenic
1143843472 17:9753727-9753749 ACCCACTTACCTCCAAGGAATGG - Intergenic
1144369875 17:14579893-14579915 AATCACTCTCTACCAAGGAAGGG - Intergenic
1144937996 17:18915713-18915735 ACTCACTCACCCCCATAGGAAGG + Intronic
1148156002 17:45425558-45425580 ACTCACTCAGTTCCCAGTGGAGG + Exonic
1149571991 17:57678585-57678607 ACTCCTTCTCTTCCAGGGGAGGG - Intronic
1149619608 17:58033554-58033576 ACTCACTCACCCTCAAGGAAGGG + Intergenic
1149714935 17:58779522-58779544 ACAAAATCACTTCAAAGGGATGG - Intronic
1149934652 17:60792636-60792658 ACTCACTCACTCCCTAGGGAGGG - Intronic
1150857429 17:68766573-68766595 ACTCACTTACCCCCAAGGTAGGG + Intergenic
1151665027 17:75540850-75540872 ACTCACACAGTGCCAAGGAAAGG + Intronic
1151945826 17:77319401-77319423 ACTCGCTCCCTCCCAGGGGACGG + Intronic
1152502447 17:80721396-80721418 AATCACTCACTTCCTCGGCAGGG + Intronic
1153212868 18:2787249-2787271 ATTCACTCACTCCCAAGGGATGG + Intronic
1155099335 18:22593723-22593745 ACTCACTCACCTTGAAGGGAGGG - Intergenic
1156110320 18:33718453-33718475 CCTCACTCACTCCCAACCGATGG - Intronic
1156622148 18:38865007-38865029 ACTTACTCATTACCAAGGGGAGG - Intergenic
1156694462 18:39749877-39749899 ATTCATTCACTCCCATGGGAGGG - Intergenic
1157904690 18:51559130-51559152 ACTCACTCACCCCCATGAGAGGG + Intergenic
1158328468 18:56335921-56335943 ACTCACTCATCACCACGGGAAGG - Intergenic
1158737031 18:60094039-60094061 AATCACTCACTTCTGAGAGATGG + Intergenic
1160121631 18:76135486-76135508 ACTCACTCATTACCATGGGGAGG + Intergenic
1160846603 19:1168800-1168822 ACTGACTCACTTGCTGGGGAGGG - Intronic
1162471837 19:10876775-10876797 ACTGCCTCCTTTCCAAGGGAGGG - Intronic
1162825646 19:13249914-13249936 GGTCACTCTCTTCAAAGGGATGG + Intronic
1163327639 19:16615369-16615391 ACTCTCTCAGTTGCAAGTGAGGG + Intronic
1163811918 19:19438446-19438468 AGTCACTCACTTCCCTGGGCTGG - Intronic
1164851347 19:31486846-31486868 ACTCATTCACGACCATGGGAGGG + Intergenic
1164858562 19:31544445-31544467 ACTCACTCATTACCATGGGGAGG + Intergenic
1164896472 19:31881717-31881739 ACTCACTCATTACCATGGAAAGG + Intergenic
1165367259 19:35375869-35375891 TCTCACTGCCTTCCATGGGATGG - Intergenic
1166573335 19:43813607-43813629 ACTGACTTACTTTCATGGGATGG + Intronic
1168515406 19:57006826-57006848 ACTCACTAAGTTCCAAAGGTGGG - Intergenic
925357285 2:3250726-3250748 ACTCAGTCATCACCAAGGGACGG - Intronic
925784450 2:7417424-7417446 ACTCACTCACCCTTAAGGGAGGG - Intergenic
930995932 2:57718008-57718030 AGTCACTCACCCCCGAGGGAAGG + Intergenic
931745426 2:65287843-65287865 ACTCGTTCCCTCCCAAGGGATGG - Intergenic
931803139 2:65778260-65778282 ACTCACTCACTCCTGAGAGAAGG + Intergenic
932022795 2:68104764-68104786 GCTCACTCACTCTCAAGGGAGGG + Intronic
934690659 2:96356268-96356290 ACTCACTGAATTCCCAGGAAAGG - Intronic
934892226 2:98080652-98080674 ACTCACTCACTCCCTTGAGATGG + Intergenic
934919312 2:98330115-98330137 AGTCACCATCTTCCAAGGGAGGG + Intergenic
935181492 2:100694940-100694962 ACTCACTCACTACCATTGGGAGG + Intergenic
935535217 2:104285676-104285698 ACACACGCACTGCCAAGAGAAGG - Intergenic
936456072 2:112675257-112675279 ACTAACTCATTACCAAGGGCAGG - Intergenic
936820819 2:116518481-116518503 ATTCATTCACCCCCAAGGGAGGG - Intergenic
936898108 2:117452087-117452109 GCTCACTCACACCCAAGGGCAGG - Intergenic
937590749 2:123610458-123610480 CCTCAAGCACTTCCAATGGAGGG + Intergenic
937793944 2:125994772-125994794 AATTACTCACTTCTAAGGCAAGG - Intergenic
938661509 2:133491647-133491669 CCTCCCTCACTTCATAGGGATGG - Intronic
938670647 2:133583291-133583313 ACTCACCCACCACCAAGGGATGG - Intergenic
939052671 2:137327070-137327092 AACTACTCACTACCAAGGGAAGG - Intronic
939078113 2:137627204-137627226 ACTCACTCTCCCCCAAGGGAGGG + Intronic
939259835 2:139792959-139792981 ACTCACCCAGATTCAAGGGAAGG - Intergenic
939888328 2:147705905-147705927 ACTCACTCACCCCCAAGGGAGGG + Intergenic
941018608 2:160384921-160384943 ACTCACTCATCACCAGGGGATGG - Intronic
941140828 2:161779230-161779252 ACTCCCTCACTACCATGAGAAGG + Intronic
943169395 2:184377580-184377602 ACTCACTCACCCCTGAGGGAGGG + Intergenic
943680018 2:190758623-190758645 ACTCACTCATTACCAAGAGAAGG - Intergenic
944160209 2:196652007-196652029 ACTCACTCATTACCATGGGGAGG + Intronic
944449392 2:199825567-199825589 ACTCACTCATTACCATGGGAGGG - Intronic
944578300 2:201111212-201111234 ACTCCCTCACCACTAAGGGAAGG + Intergenic
945639942 2:212412370-212412392 ACTCACTCATTACCAAAGGGAGG - Intronic
946468156 2:219931144-219931166 ACTCACTCATTACCACGGGGAGG + Intergenic
946575420 2:221070922-221070944 ACTCACTCACTTGAATGGCATGG + Intergenic
947703424 2:232255054-232255076 CCAGACTCACATCCAAGGGATGG + Intronic
1168865242 20:1080691-1080713 ACCCACCCAGATCCAAGGGAAGG + Intergenic
1168868696 20:1110491-1110513 ACTCACTCATTACCATGGGGAGG - Intergenic
1168927982 20:1598621-1598643 ACTCACACACTTCCTGGGGTTGG + Intronic
1169683554 20:8244561-8244583 ACCCACTCTCTTCCTGGGGAGGG + Intronic
1170721253 20:18881198-18881220 ACTCACTAATTTACATGGGAAGG - Intergenic
1170861794 20:20111425-20111447 ACTAACTCACCTCCAAGGCTGGG + Intronic
1171020651 20:21581607-21581629 ACTCACTCACTCCCATGGGAGGG + Intergenic
1171368752 20:24646432-24646454 GCTCCCTCACACCCAAGGGACGG - Intronic
1172911413 20:38411996-38412018 ACTCACTCATTACCATGGGGAGG + Intergenic
1173584086 20:44168907-44168929 ACTCACTCACCCCCAAGGGAGGG - Intronic
1174786493 20:53437761-53437783 ACTCACTCATTTCCACAGGGAGG - Intronic
1175180975 20:57147240-57147262 ACTCACTCACCTCTGAAGGAGGG - Intergenic
1175181101 20:57148277-57148299 ACTTACTCACGGCCAAGGGCAGG - Intergenic
1177155164 21:17494056-17494078 ACTCACTTATTACCAAGGGAAGG + Intergenic
1177726099 21:24970414-24970436 ACTCATTCACTACCATGAGAAGG + Intergenic
1177789317 21:25705817-25705839 ACTAACTCACTTCTAAGACATGG - Intronic
1178631588 21:34265719-34265741 ACTCACTTACCCCCAGGGGAGGG - Intergenic
1179345846 21:40556722-40556744 ACTCACTCACCCCTGAGGGATGG + Intronic
1180256574 21:46634020-46634042 ATTCAGTTACTTCCTAGGGATGG + Intergenic
1180847143 22:18989971-18989993 ACTCGCTCATTACCAAGGGGAGG + Intergenic
1181492135 22:23267206-23267228 ACTCAGTGACTTGCAAAGGAGGG + Intronic
1181696557 22:24595566-24595588 ACTCACTGACTCACTAGGGATGG - Intronic
1181719465 22:24762831-24762853 ACTCACTCACCTCCAAGGCAGGG + Intronic
1181977837 22:26743980-26744002 ACTCATTCAATTCCATGGAAAGG - Intergenic
1182001194 22:26921209-26921231 ACTCACTCACTCCCGAGGGAAGG - Intergenic
1182718185 22:32376705-32376727 CCTCTCTCACTTCCCAGGTAAGG + Intronic
1182803151 22:33048508-33048530 ACTCACTCATCACCAAGGGGAGG - Intronic
1184733347 22:46383099-46383121 ACTCGCTCATTACCAAGGGCGGG - Intronic
949392124 3:3573906-3573928 TCTCACTCACTTCCCCGTGAGGG - Intergenic
949577801 3:5355724-5355746 TCTCACCCACCTCCAAGGTAAGG + Intergenic
949761135 3:7472019-7472041 ACTCACTCACCTCCGAGGTAGGG - Intronic
951024949 3:17818245-17818267 TCTCACTCACTGCCCAGGGCTGG + Intronic
954675787 3:52314661-52314683 ACTCACTCCCTACCATGTGATGG - Intergenic
955449278 3:59049901-59049923 ACACAATCACTCCCCAGGGACGG - Intronic
956446561 3:69331670-69331692 GCACACTCACTTCCCAGGGCTGG + Intronic
958690957 3:97465622-97465644 ACTTACTCACTTTCAGGAGATGG + Intronic
960241664 3:115349559-115349581 ACTCACTCACCTCCAAGGGAGGG - Intergenic
960442159 3:117702107-117702129 ATTCACTTATTTCCAAGGGATGG - Intergenic
960524311 3:118692066-118692088 ACTCACTCAACACCAAAGGAGGG - Intergenic
961563620 3:127747879-127747901 ACTCAGCCACATCCTAGGGAAGG + Intronic
961779034 3:129310769-129310791 ACTCAGTCACTTGCAGGAGAAGG - Intergenic
961871206 3:129989551-129989573 ACTCACTCACCCCTGAGGGAAGG - Intergenic
962712475 3:138099660-138099682 ACTCCCTCACCCCCAAGGGAGGG - Intronic
962771186 3:138611678-138611700 ACCCATTCACCTCCAAGGGAGGG - Intronic
963583790 3:147159410-147159432 ACTCACTCACTACTATGAGAAGG + Intergenic
964397854 3:156266067-156266089 GCTCACTAAATTCCAAGGGGAGG - Intronic
964565371 3:158045092-158045114 ACTCACTCACTCCCACAAGAAGG + Intergenic
964903179 3:161685935-161685957 ACTCACTCATTACCATGGGGAGG - Intergenic
965083120 3:164061613-164061635 ACTCACTCATTACTAAGGGTTGG + Intergenic
966008171 3:175042878-175042900 ACTCACTAACTCCCTAGGGAGGG - Intronic
966294227 3:178400194-178400216 ACTCACTCTTTACCAAGGGAAGG - Intergenic
966469791 3:180276286-180276308 ACTCACTCATTTCCATGCAAGGG + Intergenic
968686840 4:1965838-1965860 ACTCACTCACTGTCATGAGATGG + Intronic
970160384 4:13182317-13182339 AGTGACTCAGTTCCAAGGAATGG + Intergenic
970339710 4:15093274-15093296 ACTCACTCACTCCCAAAGGGAGG + Intergenic
970477370 4:16437306-16437328 ACTCACACAATTACAAGGTAAGG + Intergenic
970809240 4:20072152-20072174 ACTCACCCACCTCCAAGAGAAGG + Intergenic
970852407 4:20617182-20617204 ACTTACTTATTTCCAAGGCAAGG - Exonic
971263864 4:25081177-25081199 ACTCACTCATTACCAAGAGGAGG - Intergenic
971431693 4:26574711-26574733 ACTCACTCACCCCCAAGGGAGGG + Intergenic
972106159 4:35491122-35491144 ATTCTCTCTCATCCAAGGGAGGG + Intergenic
972254824 4:37342185-37342207 ACTCACTCATTACCATGGGGAGG - Intronic
973824552 4:54691947-54691969 ACTCACCCACTTCCTATGTATGG - Intronic
974317194 4:60297658-60297680 ACTCACTCATTACCTTGGGAAGG + Intergenic
974912333 4:68137680-68137702 ACTCACTCCCTTCCCAGCCATGG - Intergenic
976794495 4:88917333-88917355 ACTCACTCACTTCCAAGGGAGGG + Intronic
977169537 4:93743685-93743707 ACTCACTCATCCCCAAGGAAGGG + Intronic
979820092 4:125160610-125160632 ACTCACTCACTACCATGAGGTGG + Intergenic
981260781 4:142716122-142716144 ACCCACTCAGGTTCAAGGGAGGG + Intronic
984161911 4:176263076-176263098 ACTCACTCAGCATCAAGGGAGGG - Intronic
984401382 4:179269787-179269809 ACTCACTCATTGCCATGGGGAGG + Intergenic
984902133 4:184594769-184594791 ACTCACTTATTCCCAAGAGAGGG - Intergenic
985583694 5:714867-714889 ACTCACTCCCTTCAGAGGGAGGG - Intronic
985597203 5:799164-799186 ACTCACTCCCTTCAGAGGGAGGG - Intronic
986141858 5:5038696-5038718 ACTGACTCGCTTCAAAGTGACGG + Intergenic
986561660 5:9066377-9066399 ACTGACCCACTTCCATGGAAGGG - Intronic
987243914 5:16029087-16029109 ACTCACTCACTTCCAACCCAGGG + Intergenic
987278619 5:16389249-16389271 GCTCACTCCTTCCCAAGGGAGGG + Intergenic
989050869 5:37318862-37318884 ACTAAGTCACTTACAAAGGAAGG + Intronic
989470124 5:41806541-41806563 ACTCCTGCATTTCCAAGGGATGG - Intronic
989609392 5:43276867-43276889 ACTCACACCGATCCAAGGGAAGG + Intronic
989998508 5:50864132-50864154 ACACACACACTCTCAAGGGAGGG + Intergenic
990370287 5:55110813-55110835 ACTCACTCCCTACTATGGGATGG - Intergenic
990513862 5:56514441-56514463 ACTCACTTACCTCCAAGGGAGGG - Intronic
992679565 5:79140587-79140609 ACTCACTCACTCCCACCAGAAGG - Intronic
993446614 5:88020491-88020513 ACTCACTCATCACCATGGGAAGG + Intergenic
993580153 5:89651629-89651651 ACCCACTCACCCCCAAGGGAGGG - Intergenic
993581090 5:89661699-89661721 ACTCACTCATTCCCAAGGGAGGG - Intergenic
993620524 5:90162600-90162622 TCTCACTCACTTCAAAGACAGGG + Intergenic
994898887 5:105744676-105744698 ACTCTCCCTCTTGCAAGGGATGG + Intergenic
995205084 5:109470411-109470433 ACTCACTCACCCCCAAGGAAGGG - Intergenic
995535384 5:113130638-113130660 ACTCACTCACCCACAAGGAAGGG - Intronic
995712608 5:115050428-115050450 ACCCCATCACTTCAAAGGGATGG + Intergenic
997111161 5:131076144-131076166 ACTCACTCATTACCATGGGGAGG + Intergenic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997768601 5:136530657-136530679 ACTCACTCATTACCATGGGGAGG + Intergenic
997811006 5:136970101-136970123 ACACACACACATCCAAAGGAAGG - Intergenic
998219597 5:140265916-140265938 ACTCACTCACTTCCCAATGGAGG + Intronic
999443132 5:151618371-151618393 TCACACTCACTTTCAAGGCAGGG + Intergenic
999942019 5:156553165-156553187 AGTCACTCACCCCCAATGGAGGG + Intronic
1000055757 5:157604711-157604733 ACTACCTAACTTCCAAGGCATGG - Intergenic
1000594733 5:163201913-163201935 ACTCACTTATTACCATGGGAAGG - Intergenic
1000610515 5:163368526-163368548 ACTCACTCACCCCCATGGGAGGG - Intergenic
1000699457 5:164430272-164430294 ACTCACCAACCTCCAAAGGATGG - Intergenic
1001042313 5:168345486-168345508 ACTCAATCACACCCAAGGAATGG - Intronic
1001327493 5:170739736-170739758 ACTCACTCAGCCCCAAGAGAGGG - Intergenic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1002178856 5:177419299-177419321 CTTGACTCACTTCCAATGGAAGG - Intronic
1003077334 6:2994165-2994187 ACTCACTCACCCCTGAGGGAGGG - Intronic
1003152785 6:3566616-3566638 ACTCACTCACTACCTCGGGGAGG - Intergenic
1003667101 6:8121578-8121600 ACTCACTCACCTCCAAGGAAGGG - Intergenic
1004082209 6:12405954-12405976 ACTCACTCAACATCAAGGGAGGG + Intergenic
1004240251 6:13914891-13914913 ACAAACTAACTGCCAAGGGAGGG + Intergenic
1004284170 6:14305217-14305239 GCTCACTAACATTCAAGGGAAGG + Intergenic
1004852252 6:19712247-19712269 ACTCACTCACCTCCCAGGATGGG + Intergenic
1007125168 6:39419785-39419807 GATCACACACTTCCTAGGGAAGG + Intronic
1007961923 6:45967858-45967880 ACTCACTCATTACCATGGGGAGG + Intronic
1008306705 6:49911483-49911505 ACTCACTCATTACCATGGGGAGG + Intergenic
1010554977 6:77267686-77267708 ACTCACTCACTCTTGAGGGATGG - Intergenic
1011302217 6:85888190-85888212 ACTCACTCATTATCATGGGAAGG - Intergenic
1011440167 6:87379133-87379155 GCTCACTCATTCCCATGGGAGGG - Intronic
1011783057 6:90812115-90812137 GCTCACTCAATTCAGAGGGAAGG + Intergenic
1012625204 6:101396247-101396269 ACTCACTCACTTCCTGGGGGGGG - Intergenic
1013409452 6:109871190-109871212 ACTTGTTCACATCCAAGGGAAGG - Intergenic
1013858545 6:114605298-114605320 ACCCACTCAGTTCACAGGGAAGG - Intergenic
1016845641 6:148565627-148565649 ACTCACCCACTTCTAAGGGATGG + Intergenic
1017741081 6:157407271-157407293 ACTCACTCCCTTCCCAGGGGCGG - Intronic
1018098752 6:160417594-160417616 TTTCCCTCATTTCCAAGGGATGG + Intronic
1018528606 6:164740042-164740064 AGTAATTCAGTTCCAAGGGAAGG + Intergenic
1020512621 7:9077273-9077295 TCTCTCTCTCTTCCAATGGAAGG + Intergenic
1020668453 7:11075535-11075557 ACTCACTCATTCCCATGGGAAGG + Intronic
1021023508 7:15634935-15634957 ACTCTCACACCTCTAAGGGATGG - Intronic
1021246901 7:18274461-18274483 ACTCACTCACCCCCAAGAGAAGG + Intronic
1021659997 7:22910249-22910271 ACTCACTCATTACGATGGGAAGG - Intergenic
1022513683 7:30961710-30961732 ACTCACTCATTACCATGGGGAGG - Intronic
1022525146 7:31032352-31032374 ACTCACTCATTACCATGGGGAGG - Intergenic
1024222904 7:47302406-47302428 ACTCAGTCATTTCAAAGGCAGGG - Intronic
1024247392 7:47480507-47480529 ACTCACTCAGCTCCAAAGGATGG + Intronic
1024326800 7:48115183-48115205 ACTCACTCATCACCAAGGGGAGG + Intergenic
1026619072 7:71934605-71934627 ACTCACTCATTACCATGGGGAGG + Intronic
1026641480 7:72129981-72130003 ACTCACTCACCCCTGAGGGAGGG - Intronic
1026932900 7:74234665-74234687 ACTCACTCACTACCTTGGGGTGG - Intronic
1027294963 7:76760730-76760752 ATTGACTCACTTCTAAGGAATGG + Intergenic
1027788996 7:82615713-82615735 ACTCACTCACTATCAAGAGAGGG + Intergenic
1028012381 7:85662947-85662969 ACTCTGTCACTCCCAAGGCACGG - Intergenic
1028870649 7:95768078-95768100 ACTCACTCATTACCATGGGGAGG - Intergenic
1029522812 7:101074878-101074900 ACTCACTCACTTCCCATTCAGGG - Intergenic
1030086110 7:105817080-105817102 ACTCTCTCATTTCCAAGGCCTGG + Intronic
1030602204 7:111605369-111605391 ACTCACTCATTACCAGAGGACGG - Intergenic
1030911212 7:115251641-115251663 ACTCACTCATCACCAGGGGATGG - Intergenic
1030919831 7:115369105-115369127 ACTCACTCACCCCTAAGGGAGGG - Intergenic
1031228380 7:119071879-119071901 ACTCACTCATTACAAAGGGAAGG + Intergenic
1031682742 7:124694694-124694716 ACTCACTCATTTCCATGAAAGGG + Intergenic
1032947181 7:136868397-136868419 ACTCACACACTTGCAGGGAAGGG + Intergenic
1033440152 7:141371239-141371261 ACTCACTTACCCCCAAGGAAGGG - Intronic
1033845234 7:145423964-145423986 ACTCACTCACCCCCAAAGGAGGG - Intergenic
1034493533 7:151407222-151407244 TGACACTCACTTCCCAGGGAGGG - Intronic
1034735486 7:153425540-153425562 ACTCACTTGCCCCCAAGGGAGGG - Intergenic
1034750846 7:153567717-153567739 ACTCACTCATTACCACAGGAAGG + Intergenic
1034847911 7:154464182-154464204 ACTCAGTCAATTCCCACGGACGG - Intronic
1035165698 7:156988426-156988448 ACTCAGACACCTCCCAGGGAAGG + Intergenic
1035495651 7:159323238-159323260 ACTCACAGCCTTCCCAGGGAGGG + Intergenic
1036510089 8:9392093-9392115 ACTCACTCATTACCAAGGGGAGG - Intergenic
1036791571 8:11724801-11724823 ACCCACTCACTCCCAAGGCTGGG - Intronic
1037295510 8:17396368-17396390 ACTTAGTCACTACCAGGGGATGG - Intronic
1037395054 8:18432820-18432842 ACTCATTCACCTCCAAAGGAGGG - Intergenic
1037658928 8:20910725-20910747 ACTCCCTCACTTCCCAGCTAAGG - Intergenic
1039745526 8:40422778-40422800 ACTCACTCATTTCCCATGCATGG - Intergenic
1039830373 8:41208823-41208845 ACTCCCTCACCCCCGAGGGAGGG + Intergenic
1039830465 8:41209657-41209679 ACTCCCTCACTCCCAAGGAAAGG - Intergenic
1039853524 8:41393068-41393090 ACTCACTCATTACCACAGGATGG + Intergenic
1039893490 8:41699929-41699951 ACCCACTCATTTCAAAGGGCTGG + Intronic
1039922155 8:41900977-41900999 ACTCACTCACCCGCAAGGGAGGG - Intergenic
1039948385 8:42149432-42149454 ACTCACTCATTACCATGGGGAGG - Intergenic
1040349802 8:46553069-46553091 ACTCATTCACTTTCAAAGGTAGG - Intergenic
1040651770 8:49457085-49457107 ACTGACTCATCTCCATGGGAAGG - Intergenic
1041941275 8:63390800-63390822 ACTCACACACATCTTAGGGAAGG + Intergenic
1042580896 8:70278504-70278526 AGTGACTGACTTCTAAGGGAAGG - Intronic
1044109562 8:88255171-88255193 ACTCACTCATTACCATGGGGAGG - Intronic
1044529540 8:93291634-93291656 ACTCACTCATCACCAAGGGGAGG + Intergenic
1045466323 8:102473664-102473686 ACTCACTCATCACCAAGGGGAGG - Intergenic
1045570211 8:103361136-103361158 GTTCACTCACACCCAAGGGAGGG - Intergenic
1045878540 8:107011262-107011284 ACTCACTCATTACCATGGGGAGG - Intergenic
1046671580 8:117062491-117062513 ACTCACTCATCACCAAGGCAAGG + Intronic
1047013067 8:120693153-120693175 ACTCACTCACTGCCTCGGGGCGG + Intronic
1048131278 8:131700472-131700494 ACTCACTCACTCCCACAGGAGGG + Intergenic
1048235169 8:132682941-132682963 ATTCACTCACCCCCAAGGTAAGG + Intergenic
1048468504 8:134686828-134686850 GCTCTCACACTTCCAATGGATGG + Intronic
1048503163 8:134996932-134996954 ACCCACTCAGTTACTAGGGAAGG + Intergenic
1050148295 9:2593140-2593162 ACTCACTCACTACCATTGGGAGG + Intergenic
1052066406 9:24026850-24026872 ATTCACTCACTATCAAAGGAGGG - Intergenic
1053114395 9:35489185-35489207 ACTCACTCACTGTCACGAGAAGG - Intergenic
1055180307 9:73379205-73379227 AGTCACTCATTACCATGGGAAGG - Intergenic
1056071185 9:82988598-82988620 ACTCACTCATCACCAAGGGATGG - Intronic
1056382464 9:86067597-86067619 CCACACTCATTTCCAAGGCAAGG + Intronic
1057149165 9:92780956-92780978 ACTCACTCACCCACAAGGGAGGG - Intergenic
1058366281 9:104212943-104212965 ACATACTTACTTCCAAGGAAAGG - Intergenic
1058550322 9:106107746-106107768 TCTGACTCACATTCAAGGGAGGG - Intergenic
1058814161 9:108668373-108668395 AATGACTCACCTACAAGGGATGG + Intergenic
1058841986 9:108918801-108918823 TCCCACTCACTTCCAAGCCAGGG + Exonic
1059162412 9:112047649-112047671 ACTCACTCACCTCTGAGAGAGGG - Intronic
1059244257 9:112836161-112836183 ACTCACTCACTCACATGGGCAGG - Intronic
1061220288 9:129246621-129246643 AGTCACTCACCTCTAAGGGTGGG - Intergenic
1061490652 9:130942132-130942154 ACCCACTCCCTGCTAAGGGAGGG - Intergenic
1061901261 9:133673303-133673325 ACCCACTGACTCCCATGGGAAGG + Intronic
1061984412 9:134121620-134121642 ACTCACTCACCCCCGAGGGAGGG + Intergenic
1185842226 X:3402533-3402555 ACTCACTCATTACCAGGGAATGG - Intergenic
1186432139 X:9513972-9513994 ACTCACTCAGTACCAGGGGGAGG + Intronic
1187101381 X:16196422-16196444 AATCACTCAGTCCCAAGAGAGGG - Intergenic
1187409352 X:19035739-19035761 ACTCCCAAACTTCCAAAGGATGG - Intronic
1187634204 X:21209245-21209267 ACTCACTTAATTACAAAGGAAGG + Intergenic
1188016602 X:25113583-25113605 ACTCACTCATCGCCAAGGGATGG + Intergenic
1188060916 X:25600803-25600825 ACTGACTCAATTCCAATGAATGG + Intergenic
1188095533 X:26016822-26016844 ACTCACTCATTACCATGAGAAGG + Intergenic
1188785356 X:34339124-34339146 ACTCACTAATTACCAAGGAAAGG + Intergenic
1189010298 X:37040161-37040183 ACTCACTCATTACCATGGGGAGG + Intergenic
1189038282 X:37515547-37515569 ACTCACTCATTACCATGGGGAGG - Intronic
1189258675 X:39661028-39661050 ACTCAATGACTTCCAAGGCTAGG + Intergenic
1189352386 X:40285696-40285718 ACTCACTCAGATTCAAAGGAGGG - Intergenic
1191952678 X:66610481-66610503 ACTTACTCACTTGCTAGAGAAGG + Intronic
1192304744 X:69947156-69947178 AAGCACACACTCCCAAGGGAAGG + Intronic
1192412334 X:70945033-70945055 ACTCACTCACCCCCAAGGGAGGG - Intergenic
1192604912 X:72506538-72506560 ACTCACTCACTTCTGCAGGAGGG + Intronic
1194846561 X:98816552-98816574 ACTCACTCATTACCATGGGGAGG + Intergenic
1195386480 X:104318257-104318279 ACTCACTCATCACCAAGGGATGG + Intergenic
1196728690 X:118920716-118920738 ACTCACTCAATTCTACAGGAAGG - Intergenic
1198745419 X:139885198-139885220 ACCCACTCACTTCCAAAGAGAGG + Intronic
1198817390 X:140607026-140607048 ACTCACTTATTACCATGGGAGGG + Intergenic
1199320933 X:146438229-146438251 ACTCACTCATTACCACGGGGAGG + Intergenic
1200048716 X:153416974-153416996 ACTCACTCACCCCTGAGGGAGGG + Intergenic
1200935580 Y:8735446-8735468 GCTCTCTCACTTCCATTGGAGGG - Intergenic
1201233216 Y:11885856-11885878 ACTCACTCATTACCAGGGAATGG + Intergenic