ID: 976800552

View in Genome Browser
Species Human (GRCh38)
Location 4:88986548-88986570
Sequence TGTCTTCGCCATTTGGCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976800552_976800558 28 Left 976800552 4:88986548-88986570 CCATATGCCAAATGGCGAAGACA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 976800558 4:88986599-88986621 TAGCCAGATATAGGACAGTACGG 0: 1
1: 0
2: 0
3: 3
4: 96
976800552_976800557 19 Left 976800552 4:88986548-88986570 CCATATGCCAAATGGCGAAGACA 0: 1
1: 0
2: 0
3: 4
4: 76
Right 976800557 4:88986590-88986612 GCATTCTCTTAGCCAGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976800552 Original CRISPR TGTCTTCGCCATTTGGCATA TGG (reversed) Intronic
905148210 1:35904574-35904596 TGTTTTGGCCATTTGGGGTATGG + Intronic
920210495 1:204324810-204324832 TGTCTTTGTCCTTTGGCTTAGGG + Intronic
923751275 1:236748371-236748393 TGTCACAGCCATTTGGCATTTGG - Intronic
1063275517 10:4563175-4563197 TGCCTTCTCCAGTTGGCATTTGG + Intergenic
1064851505 10:19714118-19714140 TGTCTTTGCCATGAGGCAGAGGG - Intronic
1067306482 10:45069443-45069465 TGGTTTCGCCATTGGGCATGAGG - Intergenic
1067901626 10:50247647-50247669 CATCTTCTCCATTTGGCCTAAGG + Intronic
1069242083 10:66155291-66155313 TGTCTTAGTCACTTGGCTTATGG - Intronic
1071136573 10:82460889-82460911 TTCCTTCTCCATTTGTCATATGG + Intronic
1074062618 10:109981202-109981224 TGTCATCCCCATTTTACATATGG - Intergenic
1076338215 10:129724891-129724913 TATCTTCACCATCTGGGATAAGG - Intronic
1082635873 11:55592934-55592956 TGTTTTTGTCATTTGGCTTATGG + Intergenic
1085187523 11:74589077-74589099 CATCTGCTCCATTTGGCATAGGG + Intronic
1085882556 11:80485013-80485035 TGTCTTCTCCAGTTTGCAGATGG - Intergenic
1087421630 11:97934020-97934042 TGTCTTATTAATTTGGCATACGG - Intergenic
1095090945 12:38104278-38104300 TGTCTTCGCTATTGTGAATAGGG + Intergenic
1100276505 12:93076572-93076594 TGTCTTCTCCACTTGACACATGG - Intergenic
1107384506 13:39893574-39893596 TGTCTTTGCCACTTGGCCTCAGG - Intergenic
1110425114 13:75358142-75358164 TCTCTTCAGTATTTGGCATAAGG + Intronic
1117609593 14:57468409-57468431 TGTCTTCCCAATTTGGCCTAGGG - Intergenic
1128563344 15:68682967-68682989 TCTGTTCGCCATTTGGCCCAAGG - Intronic
1130865207 15:87927687-87927709 TGTCTTCTCCATATGGCAGAAGG - Intronic
1131298369 15:91172484-91172506 TGTCTTCTTCTTCTGGCATATGG + Intronic
1131442653 15:92470587-92470609 TGTCTTCTCCATTTTACAGATGG - Intergenic
1133973393 16:10582607-10582629 TGTCTTCTACTTTTGGCAGATGG - Intergenic
1137693293 16:50444788-50444810 TGGCTTCTCCATGTGGCTTAGGG - Intergenic
1140819522 16:78649857-78649879 TGTCTTCCACATATGGTATAAGG + Intronic
1141497778 16:84421782-84421804 TATCTTCCCCATTTTGCATATGG - Intronic
1149551051 17:57540002-57540024 TGTCTGGGCCATGTGGCAAAGGG + Intronic
1153005751 18:497840-497862 TGTTTTGACCATTTGCCATAGGG - Intronic
1157015120 18:43703116-43703138 TGCATTCATCATTTGGCATATGG + Intergenic
1158817397 18:61118975-61118997 TGTCTTCACCTTTAGGTATAAGG - Intergenic
1159750072 18:72289407-72289429 TGACTTCTCCATTTGGCTGAAGG - Intergenic
1161745546 19:6057472-6057494 TGACAGCTCCATTTGGCATATGG - Intronic
1165103674 19:33456240-33456262 TGTCTACACCACTTGGCATGAGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
927229444 2:20806852-20806874 GGACTTAGCCATTTGGCCTAAGG + Intronic
930367665 2:50461427-50461449 TATGTTCGCTATTTTGCATACGG + Intronic
933642687 2:84780969-84780991 TGTTTTTGCCTTTTGGGATAAGG + Intronic
934530227 2:95081516-95081538 TATCTTCACCATTTGGCAGAAGG + Intergenic
934848419 2:97679104-97679126 TCTCTTTGCCATTTCTCATAAGG - Intergenic
936888484 2:117341206-117341228 TGTCTTCCCCTTTTCTCATAAGG + Intergenic
939487152 2:142828658-142828680 TGTCTTTGCCATTGCGAATAGGG + Intergenic
941413250 2:165186782-165186804 AATCTTTGACATTTGGCATAGGG + Intronic
942983201 2:182106674-182106696 TGTCTTTGCCATAAGGCATGGGG + Intronic
1168887061 20:1267046-1267068 TGTCTTCCCCTTCTGGCATTTGG + Intronic
1172226588 20:33309493-33309515 TGTCATCTCCATTTTGCAGATGG - Intronic
1174750266 20:53105019-53105041 TGACTTCGTCCTTTGGCATTAGG - Intronic
1177598169 21:23274410-23274432 TGTGTTCGACATTTGCTATAAGG - Intergenic
1179135379 21:38675879-38675901 TGTATTCTCAATTTGGCAAATGG + Intergenic
955816171 3:62845799-62845821 TTTCTTCCCCATTTGACATGTGG + Intronic
958079700 3:88731038-88731060 TTTGTTAGCCATGTGGCATATGG + Intergenic
960465625 3:117993797-117993819 TATTTTCTCCCTTTGGCATATGG - Intergenic
965984055 3:174729931-174729953 TGTCTTTGCCAAATGCCATAGGG - Intronic
966908751 3:184546001-184546023 TGACTTCGCGATGTGGAATAAGG + Intronic
976800552 4:88986548-88986570 TGTCTTCGCCATTTGGCATATGG - Intronic
980473154 4:133275500-133275522 TGGCTTCTCCATGTGGCTTAGGG + Intergenic
980519824 4:133917363-133917385 TGTCTTCACAAATTGGCATCTGG - Intergenic
980637053 4:135519851-135519873 TTTCTTCTACATTTTGCATAGGG - Intergenic
991317107 5:65320975-65320997 TGTCTTTGCTATTGTGCATAGGG + Intronic
992082802 5:73251143-73251165 TGTATTTGCCATTTGGTGTATGG - Intergenic
994348997 5:98722839-98722861 TGTCTTGGACATTTTGCAAATGG + Intergenic
994927614 5:106138570-106138592 TGTCTTCGCTATTGTGAATAGGG + Intergenic
995358477 5:111266702-111266724 TGTCTAAGCCCTGTGGCATATGG + Intronic
995893805 5:116987149-116987171 TGTATTAGCCCTTTGGCAGATGG - Intergenic
1005893367 6:30158167-30158189 TATCTTCCCTATTTGGCAGATGG + Intronic
1007706506 6:43794518-43794540 TGTCGTCGTGATTTGGCACAAGG + Intergenic
1022012187 7:26317988-26318010 TGTCTTCGGCATCTAGGATATGG + Intronic
1024311574 7:47974448-47974470 TTTCTTTGCCATTTGACACATGG - Intronic
1030303495 7:107997779-107997801 TGTCTTTGCTATTTGGGATTTGG - Intronic
1034827109 7:154275516-154275538 TGTCTTCTCAATTTGGAACAAGG - Intronic
1034996779 7:155582326-155582348 GATCTTCCCCTTTTGGCATAAGG + Intergenic
1037049427 8:14351778-14351800 TGTCTTAACTATTTGGCAAATGG + Intronic
1045493795 8:102690932-102690954 TGTCATCTCCATTTTACATATGG - Intergenic
1046773803 8:118142527-118142549 TGTCTTCGGCATTGGGAACACGG + Intergenic
1058759056 9:108112275-108112297 TGTCTTTACCATTTACCATATGG - Intergenic
1186211359 X:7253653-7253675 CGTCTTCTCCTTTTGGCATCTGG + Intronic
1186779438 X:12898257-12898279 TGTCTTAGTCATATGGCATTTGG + Intergenic
1195791750 X:108595833-108595855 TATCTTCCCCATTTTCCATATGG + Intronic
1197889791 X:131257904-131257926 TATCATCTCCATTTGGCAGATGG - Intergenic