ID: 976802492

View in Genome Browser
Species Human (GRCh38)
Location 4:89008238-89008260
Sequence CTGTGGGCACATTGGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 375}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976802492_976802507 29 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802507 4:89008290-89008312 AAGGTTAAATGAGGCCACAAGGG 0: 1
1: 29
2: 192
3: 509
4: 1136
976802492_976802500 -2 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802500 4:89008259-89008281 AGTGGAAGACAGCACCTTTAAGG 0: 1
1: 0
2: 1
3: 11
4: 142
976802492_976802501 1 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802501 4:89008262-89008284 GGAAGACAGCACCTTTAAGGAGG 0: 1
1: 0
2: 2
3: 32
4: 269
976802492_976802506 28 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802506 4:89008289-89008311 GAAGGTTAAATGAGGCCACAAGG 0: 1
1: 2
2: 66
3: 318
4: 900
976802492_976802503 10 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802503 4:89008271-89008293 CACCTTTAAGGAGGCAAGGAAGG 0: 1
1: 0
2: 2
3: 18
4: 246
976802492_976802505 20 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802505 4:89008281-89008303 GAGGCAAGGAAGGTTAAATGAGG 0: 1
1: 3
2: 33
3: 284
4: 1153
976802492_976802502 6 Left 976802492 4:89008238-89008260 CCTAGCCCCCAATGTGCCCACAG 0: 1
1: 0
2: 2
3: 29
4: 375
Right 976802502 4:89008267-89008289 ACAGCACCTTTAAGGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976802492 Original CRISPR CTGTGGGCACATTGGGGGCT AGG (reversed) Intronic
900314395 1:2049908-2049930 CTGGGGGCGGAGTGGGGGCTGGG + Intergenic
900428552 1:2591634-2591656 CTGTGGGCATGTTGGGGGCGTGG + Intronic
900478651 1:2887858-2887880 CTAGGGGCACACAGGGGGCTAGG - Intergenic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
901666977 1:10831647-10831669 CTGTGGGCCCAGTGGGCCCTGGG + Intergenic
902416257 1:16241501-16241523 ATATGGTCACATTGGGGGCTAGG + Intergenic
902926763 1:19700919-19700941 CCCTGGCCACATTGGGTGCTGGG + Intronic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
903151852 1:21415318-21415340 CAGTGGGAACCTTGGGGGCAGGG - Intergenic
904207701 1:28865488-28865510 CTTTGGGCACATTAGGGGGAAGG + Intergenic
904371080 1:30047716-30047738 CTGTGGCCCCATTGGGTTCTTGG - Intergenic
904409989 1:30319556-30319578 CTGTGGGGACATAGGAAGCTGGG - Intergenic
905841759 1:41186616-41186638 ATGTAGTCACATTGGGGGTTAGG - Intronic
906674611 1:47684218-47684240 ATGAGAGCACTTTGGGGGCTGGG - Intergenic
908097850 1:60759078-60759100 TGGTGTGCACACTGGGGGCTGGG - Intergenic
908209076 1:61881290-61881312 CTGTGGGGACTTTGTGTGCTGGG + Intronic
908832942 1:68199272-68199294 CTGTGAGCAAATGGGGGTCTGGG - Intronic
913482348 1:119300802-119300824 CTGTGGACAAATTCAGGGCTAGG + Intergenic
913680926 1:121186545-121186567 CTGGGGCCACGTCGGGGGCTAGG + Intronic
913988357 1:143585799-143585821 CAGTGGGAACCTTGGGGGCAGGG - Intergenic
914032756 1:143974184-143974206 CTGGGGCCACGTCGGGGGCTAGG + Intergenic
914156688 1:145093781-145093803 CTGGGGCCACGTCGGGGGCTAGG - Intronic
915313305 1:155015314-155015336 CTGTGGGCACCTCAGGGACTAGG - Exonic
915750065 1:158198935-158198957 CTGTTGGCACTTTGGTGGCCAGG + Intergenic
919751111 1:201038828-201038850 CTGTGGGGACATGGAGGGCCCGG + Intergenic
920468239 1:206205069-206205091 CTGGGGCCACGTCGGGGGCTAGG + Intronic
922766053 1:228157235-228157257 CTGGTGGCACTTTGGGGTCTGGG + Intronic
922772227 1:228192095-228192117 CTGGGGGCCCATAGGGTGCTGGG + Intergenic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
923604855 1:235433967-235433989 CTGTGGGCACTTTGAGGCCTTGG - Intronic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
1062788363 10:284151-284173 CTGTGGAGACATTCTGGGCTTGG + Intronic
1065794357 10:29292344-29292366 CGAGGGGCACATCGGGGGCTGGG - Intronic
1067187622 10:44043875-44043897 TTGTGGGCCCATTGTGTGCTGGG + Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1067694946 10:48527937-48527959 CAGTGGGCACAATGGGCTCTGGG + Intronic
1067841340 10:49681861-49681883 CTGTAGTCACATTGGGAGTTAGG + Intronic
1068028130 10:51674324-51674346 CTGTTGGGGGATTGGGGGCTAGG - Intronic
1069694833 10:70378992-70379014 CTGTGGGCAGCTTGGGGCCAGGG + Intronic
1070121075 10:73577967-73577989 CTGTGAGCAAAGTGGAGGCTTGG - Intronic
1070155641 10:73833256-73833278 CTGTGGAAAGATTGGAGGCTGGG - Intronic
1070382462 10:75893231-75893253 CTGAGGGCTCAGTGGGTGCTAGG + Intronic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1072623413 10:97095862-97095884 TTGTGTGCACATTAGTGGCTGGG - Intronic
1075466454 10:122655120-122655142 CCCTGGGCACATTGGGCGCATGG + Intergenic
1075688248 10:124378648-124378670 CTGTGGGCACCATGGAGTCTGGG - Intergenic
1076199759 10:128548675-128548697 CTGTGAGCACATTCAGGGCAGGG + Intergenic
1076379702 10:130016585-130016607 CTGTGGGCCCATTCAGGGCCAGG - Intergenic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1077898408 11:6471543-6471565 CTCTGGGCACACTGTGGGCCAGG + Intronic
1077957715 11:7038886-7038908 CTAGGGGCAAATCGGGGGCTAGG + Intronic
1078060274 11:8038863-8038885 CTGTGGCCACGATGGGGGCCAGG + Exonic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078587971 11:12610479-12610501 CTGCGGCCACTTTGGGGGATGGG - Intergenic
1079090555 11:17477120-17477142 GTGTGGGCACACTGGAGTCTGGG + Intergenic
1079584856 11:22113201-22113223 CTGTCGGTAGATGGGGGGCTAGG + Intergenic
1079816634 11:25068152-25068174 CTGGGGGCCTGTTGGGGGCTGGG + Intronic
1080297937 11:30751697-30751719 CTGTGGTCACATATGGAGCTAGG - Intergenic
1081895292 11:46580754-46580776 CTGTGGGTACATTGTGGGGAGGG - Intronic
1082295048 11:50430623-50430645 CTGAGAGCACATTGAGGCCTCGG + Intergenic
1082594381 11:55057631-55057653 CTGTGAACACATTGAGGTCTAGG - Intergenic
1083900014 11:65638969-65638991 CTCTGGGCACATTCAGCGCTCGG - Intronic
1085728741 11:78978197-78978219 CTGTTGGCGGATGGGGGGCTAGG + Intronic
1085800545 11:79585388-79585410 ATATGGGCAGAGTGGGGGCTTGG + Intergenic
1088855802 11:113752362-113752384 ATCTAGTCACATTGGGGGCTAGG - Intronic
1088913989 11:114213054-114213076 CTGTGGGCACACAGGGGGTCGGG - Intronic
1089519886 11:119056711-119056733 CTGTGGGCACAGCGGGGCCGGGG - Intronic
1089971680 11:122698687-122698709 CTGTGGGATCATTGGGAGTTAGG - Intronic
1090247276 11:125225277-125225299 CTGTGGGCTCCTTGAGGGCAGGG + Intronic
1090369480 11:126238356-126238378 CTGTGTGTACATAAGGGGCTTGG + Intronic
1090447071 11:126773709-126773731 CTGTGAGCTCCTTGGAGGCTGGG + Intronic
1090576786 11:128113398-128113420 CTGTCGGCAGGTGGGGGGCTGGG + Intergenic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1092214787 12:6673347-6673369 ATGTGGGCACTTGTGGGGCTTGG + Exonic
1093799126 12:23350686-23350708 CTGTGGGAACATTCAGGACTGGG - Intergenic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1095117265 12:38369602-38369624 CTTTGGGGACTTTGGGGACTTGG - Intergenic
1096134649 12:49189156-49189178 CTCTGGGCAGATTGGGGGTCTGG - Exonic
1097151289 12:56981707-56981729 CTGTGGGCTCATGGGCAGCTGGG - Intergenic
1097370923 12:58779780-58779802 CTGTGGGAAGCTTGGGGGCTAGG - Intronic
1098045853 12:66399748-66399770 CTGTGGCCAAATAGGAGGCTTGG + Intronic
1101218426 12:102609354-102609376 CTGTCAGGGCATTGGGGGCTAGG + Intergenic
1101597902 12:106183484-106183506 GTGTGGGCACAGTGGTGGCTGGG + Intergenic
1101722101 12:107359158-107359180 CTGTGCTCAAATTGAGGGCTGGG + Intronic
1101951288 12:109177922-109177944 CTGTGTGCACATGAGGGCCTGGG - Intronic
1102041693 12:109805146-109805168 CTGTGGGCACCTTGAGGGCAGGG + Intronic
1102787234 12:115614690-115614712 CTGTGGGCCCCAAGGGGGCTGGG + Intergenic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103850576 12:123930335-123930357 CTGTGTGCACCCTGGGGGCCCGG - Exonic
1104192354 12:126494286-126494308 CTCTTGGCACAGTGAGGGCTGGG + Intergenic
1104430448 12:128711711-128711733 CTGTGAGCACCTTGAGGTCTCGG - Intergenic
1104844045 12:131838073-131838095 TTGTGGGCAGATAGGGGGCTGGG + Intronic
1104937903 12:132376368-132376390 CTGTTGGCACCTTGATGGCTGGG - Intergenic
1104971891 12:132534533-132534555 GTGTGGGCACATGTGGGGCAGGG - Intronic
1105008704 12:132739793-132739815 CTGTGGTCACGCTGGGGCCTCGG - Intronic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1106767595 13:32930488-32930510 CTGTTGGGGCATGGGGGGCTAGG - Intergenic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1108495060 13:51017289-51017311 CTGGGGGCTCCTTGGGGGCGAGG - Intergenic
1113579811 13:111420950-111420972 CAGTGGCCACATGGGGTGCTGGG + Intergenic
1113675106 13:112201821-112201843 CTGTGTGCACATTGGAAGCTGGG + Intergenic
1113892953 13:113746031-113746053 CTTTGGGCAAATTGGGGTGTGGG - Intergenic
1113948747 13:114059587-114059609 CTGCGGGCACAGAGGGCGCTCGG + Intronic
1114712697 14:24794608-24794630 GGGTGGGCACATTGGGGCTTGGG + Intergenic
1115671895 14:35622358-35622380 CTGTTGGGGGATTGGGGGCTGGG + Intronic
1115755702 14:36524632-36524654 CTGTGGGCAGGCTGGGGGGTGGG + Intergenic
1116281577 14:42914985-42915007 CTGTGTGCAGATTGGGGACTTGG - Intergenic
1118140220 14:63072409-63072431 CTGTGGGCTCCATGGGAGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120582920 14:86276414-86276436 ATGTGGGCGCATTGTGGTCTAGG - Intergenic
1121007664 14:90500646-90500668 ATGTGAGCACAGTGGGGGCCTGG + Intergenic
1121228622 14:92340260-92340282 CTGTGGGCTCACTGAGGACTGGG - Intronic
1121595505 14:95158651-95158673 CTGTGTGCACATTGTGAGGTAGG + Intergenic
1121660638 14:95632642-95632664 CTGTGGGGTTATTGGAGGCTGGG - Intergenic
1121701788 14:95960326-95960348 CTGTTGGGGCATGGGGGGCTAGG + Intergenic
1121813679 14:96913099-96913121 CTGTGGGCAGATGGGGGGAAAGG + Intronic
1122730943 14:103797606-103797628 CTGTAGGCATTTTGGGGGCGGGG - Intronic
1122772351 14:104103038-104103060 CAGTGGGCACAGTGGGTGCCTGG + Intronic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1124340972 15:28888942-28888964 CTGTGTGCCCGGTGGGGGCTGGG + Intronic
1124340988 15:28889001-28889023 CTGTGTGCCCAGCGGGGGCTGGG + Intronic
1124966131 15:34434693-34434715 CTGTGTGCCCATCGGGGGCTGGG - Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1125681925 15:41536362-41536384 CTGAGGTCAGGTTGGGGGCTGGG - Intronic
1126161581 15:45618971-45618993 CTGTGGGCATGATGGGGGCCAGG + Intronic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1128335128 15:66780896-66780918 CTGTCTGCACAGTGGGAGCTGGG - Intronic
1128879222 15:71227752-71227774 CCGTGTCCACATTGTGGGCTCGG - Intronic
1129555569 15:76504878-76504900 CTGTGTTCACATTTGTGGCTGGG + Exonic
1131228520 15:90644258-90644280 CTTTTGGCACATGGGGTGCTGGG - Intronic
1131382764 15:91977606-91977628 GTGTGGGGACATTGGGAGGTGGG + Intronic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133907993 16:10039128-10039150 CAGTGGGGACATTGGGGGGTGGG - Intronic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1138850067 16:60617299-60617321 CAGTGGGCACTTTGGGCTCTGGG + Intergenic
1139423555 16:66864486-66864508 CGGTGGGGACATGTGGGGCTTGG - Intronic
1139850780 16:69950749-69950771 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1139879764 16:70173661-70173683 CTGTGGGCTCAAAGGGGGGTGGG - Intronic
1140372760 16:74421887-74421909 CTGTGGGCTCAAAGGGGGGTGGG + Intronic
1140594540 16:76393517-76393539 CTGTGAGCACTTTGGGGCCCAGG - Intronic
1140869943 16:79096935-79096957 CTGTGGGCATATTGGGGAGGGGG + Intronic
1141144101 16:81516691-81516713 CTGTGGGCTCCCTGGGGGCTGGG + Intronic
1141370023 16:83478377-83478399 CTGTGGTCAGACTGGGAGCTGGG - Intronic
1141737144 16:85861295-85861317 CACTGTGGACATTGGGGGCTGGG - Intergenic
1141963663 16:87426470-87426492 CTGTGTGCACATTGGGCTTTGGG - Intronic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142144325 16:88486519-88486541 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144353 16:88486657-88486679 CTGGGTGCACAGTGGGTGCTAGG + Intronic
1142144366 16:88486710-88486732 CTGGGGGCACAGTGGATGCTGGG + Intronic
1143181304 17:4986156-4986178 CTGTGGCCACATTGGGAACCTGG + Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145273631 17:21417633-21417655 CTGTGGGCCCAGTGGGGACGGGG - Exonic
1145311826 17:21705075-21705097 CTGTGGGCCCAGTGGGGACGGGG - Intergenic
1147175639 17:38654597-38654619 CTGTGGGGCCACTGAGGGCTGGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1148051463 17:44771992-44772014 CTGGGGGCACAGGGGGAGCTGGG - Intronic
1148094692 17:45044239-45044261 CTGTGGGGACATTGGGGCACAGG - Intronic
1148687571 17:49509275-49509297 GGGTGGGCAAAGTGGGGGCTGGG + Intronic
1148778916 17:50110860-50110882 GTCTGGGCACAGTGGGGGCTGGG - Exonic
1149678472 17:58487672-58487694 CAGTGGGCACATGGGCGGCGGGG - Intronic
1150371117 17:64638936-64638958 CTGTGGGCACTTTTGGGGTCTGG - Intronic
1151253052 17:72852686-72852708 CTGTGCACACATTGGGGGAAGGG + Intronic
1152587360 17:81195033-81195055 CTGTGGGCACAGTCAGGGCCGGG + Intronic
1152723845 17:81935742-81935764 CTGGGGGCAGATTGGTGGCATGG - Intronic
1153288896 18:3481190-3481212 CTGTGTGCAGTTTGGGAGCTTGG + Intergenic
1153465218 18:5380888-5380910 AGGTGGGCACATTGGGATCTAGG - Intergenic
1153642582 18:7169585-7169607 CTATGGGCATTTTGGGGACTTGG + Intergenic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1153953530 18:10076718-10076740 CTGTTGGCACAGAGGGAGCTTGG - Intergenic
1155087153 18:22470028-22470050 CTGGGGGAACCTTGGGGTCTTGG - Intergenic
1155825741 18:30440363-30440385 CTGTTGGCAGGTTGGGGGCCAGG - Intergenic
1156948511 18:42864861-42864883 TTGTGGGCACATGGTGAGCTGGG - Intronic
1157320796 18:46632353-46632375 CTGTGAGCACCTTGAGGGCAGGG + Intronic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1160226207 18:77013292-77013314 CTGTGTGCACACTGGGCTCTGGG + Exonic
1160542850 18:79634590-79634612 TTGGGGGCACAGTGGGGGCGAGG - Intergenic
1163492274 19:17623783-17623805 CTGTGGGCACATTAGGGAGTGGG - Intronic
1163691096 19:18738945-18738967 CTGGGGGCACTTTGGGGCTTGGG + Intronic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1163828265 19:19535693-19535715 AGGGGGGCACATTGGGGCCTGGG + Exonic
1164338946 19:24366387-24366409 TTGTGAGCACATTGAGGGCATGG + Intergenic
1165137342 19:33677919-33677941 CACTGGGCACCTGGGGGGCTTGG + Intronic
1165347645 19:35258902-35258924 GTGAGGGCACCTTGGAGGCTGGG - Intronic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166195515 19:41203305-41203327 CTTTGGGCTCAGTGAGGGCTGGG + Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1168078615 19:53993481-53993503 CTGTAGGCACATTCTGGTCTTGG - Intronic
1168312151 19:55465680-55465702 GTGGGGGCATATTGGGAGCTGGG + Intergenic
1168463659 19:56584177-56584199 CCTTGGGCAGATTGGGGCCTTGG + Intronic
925484054 2:4308637-4308659 CTGTTGGGGGATTGGGGGCTAGG - Intergenic
925732115 2:6926593-6926615 GTGTGGGTACAGTGTGGGCTGGG + Intronic
925971959 2:9112284-9112306 CTGTTGACACATTGCAGGCTCGG - Intergenic
926205236 2:10830879-10830901 CTGTGGTCTCCTTGGGCGCTTGG + Intronic
927211571 2:20642178-20642200 CTGTGGGCACAGTCCGGGCCTGG - Intronic
927490668 2:23518996-23519018 CTGTGGGCCTAGTGAGGGCTGGG + Intronic
927870300 2:26618939-26618961 CTTTGGGCACTTTGGGCACTTGG + Intronic
928255993 2:29723127-29723149 CTGTGGGGCCTTTAGGGGCTAGG - Intronic
928371201 2:30741474-30741496 CTGTGTGCACATAGGTGGTTTGG + Intronic
928748420 2:34442891-34442913 CTGTGGGCATTTTGGGGTCCAGG + Intergenic
930098028 2:47581872-47581894 CTGTGAGGTCATTTGGGGCTGGG + Intergenic
930556550 2:52903092-52903114 CTGTGGCCACCTTGGGGGTGGGG + Intergenic
931944046 2:67285333-67285355 CTGTGGGCACAGTGGTTCCTAGG + Intergenic
935730076 2:106057889-106057911 CTGTCGGCGGGTTGGGGGCTAGG + Intergenic
936064360 2:109319376-109319398 CTGTGGGCTCAGTGGGGTCCCGG + Intronic
936829486 2:116625433-116625455 CTGTGGGGGGGTTGGGGGCTAGG + Intergenic
937034327 2:118768511-118768533 CTGTGGGCCCAGTGCTGGCTAGG - Intergenic
937724780 2:125149728-125149750 CTGTGGGGGGATAGGGGGCTGGG - Intergenic
938298615 2:130194304-130194326 CTGTGGAGACCTGGGGGGCTGGG + Exonic
938458116 2:131480209-131480231 CTGTGGAGACCTGGGGGGCTGGG - Exonic
940437832 2:153675538-153675560 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
940921688 2:159314859-159314881 CTGTGGGGGGATTGGAGGCTAGG + Intergenic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
941902495 2:170691794-170691816 CTGTGGGCTCCTTGGGGGCAGGG - Intergenic
942528516 2:176882423-176882445 CTGTTGGGAAGTTGGGGGCTGGG + Intergenic
942832397 2:180252581-180252603 CTGTTGGAAGGTTGGGGGCTAGG - Intergenic
945800373 2:214421552-214421574 CCGTGTGCACATTGGGAGATCGG + Intronic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
946018234 2:216621163-216621185 CTCTGGGGACACTGGGGACTGGG + Intergenic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
946575586 2:221071929-221071951 CTGTGTGCACCTTTGGGACTTGG - Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948825918 2:240573421-240573443 CTGAGGGCACATGGGTGGCAGGG - Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
1172597417 20:36159022-36159044 CTGTGGGGACTTGGAGGGCTGGG + Intronic
1173598009 20:44272229-44272251 CAGAGGGCACATGGAGGGCTTGG + Intronic
1173826431 20:46050742-46050764 CTGTGAGCACCTCGAGGGCTGGG - Intronic
1174463530 20:50699722-50699744 CTGTGCCCAGAGTGGGGGCTTGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175529776 20:59666463-59666485 CTGTGGGCACATTGAGCTGTGGG + Intronic
1175540211 20:59743508-59743530 TTGTGGGCACCTTAGGGTCTGGG - Intronic
1175553916 20:59834279-59834301 CTGTGGGCAGCATGGGGGCCAGG + Intronic
1177471324 21:21563999-21564021 CTGTGTGCACACTAGGGACTTGG + Intergenic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1180261914 21:46676558-46676580 CTGTTGGGGGATTGGGGGCTAGG - Intergenic
1180954975 22:19737517-19737539 CTGTGGCCATATTGGGGGCGGGG - Intergenic
1181138573 22:20786916-20786938 CCGTGGTCACAGTGGTGGCTTGG - Exonic
1182851908 22:33482539-33482561 CTGTCGGGAGGTTGGGGGCTAGG + Intronic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1183098341 22:35568061-35568083 CTGAGGGCTCAGTGGGGGCGGGG - Intergenic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183321071 22:37165521-37165543 CTCTGGGCTCCTTGAGGGCTGGG - Intronic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1183832651 22:40426660-40426682 CTGGGGGCAGCTTGGAGGCTGGG - Intronic
1184094269 22:42308203-42308225 CTATAGGCACCTTGGGGGCCAGG - Intronic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
1184472088 22:44701975-44701997 CTGTGGGCACGTGGGGCCCTCGG + Intronic
1184512024 22:44939529-44939551 CTGTGAGCACAGTGGGGACCAGG + Intronic
1185019012 22:48362667-48362689 CTGTGAGCACACAGAGGGCTAGG - Intergenic
950193915 3:10995749-10995771 AGGTGGGCACATTTTGGGCTAGG - Intronic
950700719 3:14743859-14743881 CTGTGTGCAGCTTAGGGGCTTGG - Intronic
952935773 3:38397254-38397276 CTTTGGGGACATTGGAGTCTTGG + Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953433947 3:42863853-42863875 CTGTTGGGGGATTGGGGGCTAGG + Intronic
953719391 3:45342050-45342072 CTGGTGGCACACTGGTGGCTGGG + Intergenic
954082590 3:48221372-48221394 CTGTGGGACACTTGGGGGCTTGG - Intergenic
954455671 3:50598480-50598502 CTGTGGGCACACTGGAGCATAGG - Intergenic
955422140 3:58749354-58749376 CTGTGGGTAAAGTGGGGGTTAGG - Intronic
955899889 3:63741332-63741354 CTCAGAGCATATTGGGGGCTTGG - Intergenic
956681521 3:71785562-71785584 CTGTGGACACATAGGGGGCGGGG + Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
957584710 3:82118891-82118913 CTGTCGGGGCATAGGGGGCTAGG + Intergenic
960153124 3:114271373-114271395 CTGTGGGCACTGTGGGGGATAGG + Intergenic
961317610 3:126051259-126051281 CCGTAAGCACACTGGGGGCTGGG + Intronic
961563412 3:127746801-127746823 CTGGAGGGAGATTGGGGGCTGGG - Intronic
963269836 3:143275282-143275304 CTTTGGGCATCTTGGGGGCAGGG - Intronic
963771464 3:149390659-149390681 CTGTGGGAACTTTAGGGACTTGG + Intergenic
965327881 3:167330487-167330509 ATGTAGTCACATTGGGGGTTAGG - Intronic
967192047 3:186992862-186992884 CTGTGAGCACCTTAGGGGCAAGG - Intronic
968520393 4:1032400-1032422 CTGGGGGCACAGTGGCTGCTGGG + Intergenic
968648369 4:1750780-1750802 CTGTGGGCACAGGGGGGTCGGGG - Intergenic
969454604 4:7294241-7294263 CTGTGGGCAGATTTGGGGTGGGG + Intronic
969675754 4:8613510-8613532 CTGTGGCTACACTGGGGTCTGGG + Intronic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
970685768 4:18565356-18565378 CTGTTGGTAGGTTGGGGGCTAGG + Intergenic
972167223 4:36302018-36302040 GTGTGGGCATGTTGGGGGCCAGG + Intronic
975097196 4:70470251-70470273 CTGTTGGCAGGTGGGGGGCTGGG + Intronic
976003585 4:80401386-80401408 CTGTGTGCACACTAGGGACTTGG + Intronic
976050718 4:81009087-81009109 CTGTGTGGACCTTGGGGACTTGG + Intergenic
976461765 4:85320350-85320372 CTGTGGGCACATGGTGGGAGGGG + Intergenic
976783083 4:88783672-88783694 ATATGGTCACATTGGGGGTTAGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978939043 4:114415382-114415404 CTGTGGGCACTCTAGGGACTTGG + Intergenic
980567985 4:134571003-134571025 CTGTCGGCAGTTGGGGGGCTAGG - Intergenic
981238996 4:142452050-142452072 CTGTCGGCAGGTGGGGGGCTAGG - Intronic
981271105 4:142847338-142847360 CTGTGGGCTTGTTAGGGGCTAGG - Intronic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
982502492 4:156174188-156174210 CTGTGGTCACATGGGGGGAAGGG + Intergenic
984035391 4:174661622-174661644 CAGTGGGGCCATTGGGGGATGGG - Intronic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
985650312 5:1104537-1104559 CTCTGGGAAGTTTGGGGGCTGGG - Intronic
985699362 5:1361238-1361260 CAGTGGGCTCATTGGGGGGTGGG + Intergenic
986058632 5:4164985-4165007 GTTTTGGCACATTGGTGGCTTGG + Intergenic
986485115 5:8228404-8228426 CTTTGGGCACAGTGGGAGTTAGG - Intergenic
987966787 5:24887636-24887658 CTGTTGGCAGGTGGGGGGCTGGG + Intergenic
988420922 5:31005398-31005420 CTGTTGGCATCTGGGGGGCTAGG - Intergenic
989188293 5:38645578-38645600 CTGTGGGAAGCTTGGGAGCTGGG + Intergenic
992266041 5:75019092-75019114 TTATGAGCACATTGGGGGTTAGG - Intergenic
994271537 5:97783046-97783068 CTGTGTGCACCCTGGGGACTTGG - Intergenic
994347201 5:98700844-98700866 CTGTGGGCTGTATGGGGGCTGGG + Intergenic
994706989 5:103219104-103219126 CTGTTGGGAGGTTGGGGGCTAGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996204955 5:120722020-120722042 CTGTTGGCAGGTAGGGGGCTAGG - Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
997217205 5:132122673-132122695 CTGTCGGGAAGTTGGGGGCTAGG + Intergenic
997807053 5:136928405-136928427 CTGTTGGGAGATGGGGGGCTAGG - Intergenic
998796227 5:145822152-145822174 CTTTGGGGACACTGGGGCCTAGG - Intronic
999127321 5:149255249-149255271 CTGTGGGCCCCTTGAGGGCAGGG + Intronic
999321818 5:150619863-150619885 CTGGGGTCACACAGGGGGCTGGG + Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1000663800 5:163969759-163969781 CTATAGTCACATTGGGGGTTAGG + Intergenic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1002570740 5:180137980-180138002 CTGTGGGCTCGGTGGGGGGTGGG + Exonic
1003032363 6:2612983-2613005 CTGTCGGGAGATGGGGGGCTAGG + Intergenic
1003355437 6:5365097-5365119 CTGTGGGCAGATTTGGCCCTTGG + Intronic
1003811639 6:9789248-9789270 CTGTCGGGGGATTGGGGGCTGGG - Intronic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1007295364 6:40816894-40816916 ATGTGGGCAAATTGGGGGCCAGG + Intergenic
1007520757 6:42450783-42450805 CTGCGGGCTCTGTGGGGGCTGGG - Intronic
1007566348 6:42853844-42853866 TTGTGGGCACACAGGGGACTGGG - Intronic
1007733450 6:43965752-43965774 CTGTGTGTATATTGGGGGTTGGG - Intergenic
1007777855 6:44233703-44233725 CAGTGGGGACATTGTGGGTTTGG + Exonic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1008719684 6:54333461-54333483 CTGTCGGGGGATTGGGGGCTAGG + Intronic
1010903401 6:81455597-81455619 TTGTGGCCACATTGTGTGCTAGG - Intergenic
1011784205 6:90826210-90826232 CTGTGTGCACCCTGGGGACTTGG + Intergenic
1012284709 6:97374834-97374856 CTGTCGGGCAATTGGGGGCTAGG - Intergenic
1012430899 6:99162726-99162748 CTGTATGGATATTGGGGGCTGGG - Intergenic
1012472779 6:99589681-99589703 CTGTGGGCAAATTCAGGGGTGGG + Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1014000647 6:116362398-116362420 ATATGGTCACATTGGGGGTTGGG - Intronic
1015200328 6:130572413-130572435 CTGTGGGGGCATGGGGGGCCAGG + Intergenic
1015557263 6:134476201-134476223 CTGTCGGCGGGTTGGGGGCTGGG - Intergenic
1018223219 6:161602856-161602878 CTGTGGGCTCTTTGAGGGCAAGG - Intronic
1018343503 6:162877429-162877451 CTGTTGGGAGGTTGGGGGCTAGG + Intronic
1018612961 6:165661875-165661897 CTGGGGGCAGGTGGGGGGCTTGG - Intronic
1019738291 7:2661037-2661059 CTGTGGGCTCCTGGGGGTCTTGG - Intronic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1022174425 7:27859713-27859735 CTGTTGGGGCATGGGGGGCTAGG + Intronic
1023558948 7:41452428-41452450 ATGTGGACACACTGGGGCCTCGG - Intergenic
1023664891 7:42512885-42512907 CTGGGTGCACATTGTGGGGTTGG - Intergenic
1024207172 7:47173668-47173690 CTGTTGGCACATGGAGGGCATGG + Intergenic
1024349310 7:48347605-48347627 CTGTGGGAACACAGAGGGCTGGG - Intronic
1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG + Intergenic
1024508819 7:50186363-50186385 CTCTGGGCTCCTTGGGTGCTGGG + Intergenic
1026442959 7:70459895-70459917 ATGAGGGCACACTGAGGGCTGGG - Intronic
1026569844 7:71520060-71520082 CTGTGAGCTCTTTGAGGGCTGGG - Intronic
1027400163 7:77798689-77798711 CTGTGGGCCCAATGGGAGCACGG - Intergenic
1028019906 7:85757105-85757127 CTGTTGGGGCATGGGGGGCTAGG + Intergenic
1029053316 7:97712567-97712589 CTGTTGGGGGATTGGGGGCTGGG + Intergenic
1029709293 7:102290796-102290818 CCTTGGCCACATTGGAGGCTGGG + Intronic
1030214655 7:107032090-107032112 ATGCGGTCACATTGGGGGTTAGG - Intergenic
1030331198 7:108272894-108272916 CTGTTGGCAGGTGGGGGGCTGGG - Intronic
1035990849 8:4488727-4488749 CTGAGGGCCCATTTGGTGCTGGG - Intronic
1037238296 8:16747832-16747854 CTGTGGGCACATATGATGCTTGG - Intergenic
1037626504 8:20611968-20611990 CTGTCAGCGGATTGGGGGCTCGG - Intergenic
1040919404 8:52599719-52599741 CTGAGGCCACCTTGGGGCCTGGG - Intergenic
1042022803 8:64387843-64387865 CTGTGGGCATATTTTGGGATAGG - Intergenic
1044475106 8:92616794-92616816 ATATGGTCACATTGAGGGCTAGG + Intergenic
1047146296 8:122203047-122203069 CTGTTGGGAGATGGGGGGCTAGG + Intergenic
1048829128 8:138459050-138459072 CTGTGGGCTGATTTGGGGGTGGG - Intronic
1048910899 8:139134087-139134109 CTGTCGGGGCATGGGGGGCTAGG - Intergenic
1049102563 8:140590091-140590113 CCGTGGGCTCATTGGTGGCCCGG - Intronic
1049367843 8:142249298-142249320 CTGTGGGCAGAGGGTGGGCTGGG + Intronic
1049501818 8:142971269-142971291 CTGTGGGGACCTGGGGGGGTTGG - Intergenic
1049707016 8:144047692-144047714 CTGAGGGCAGATGGGGTGCTGGG + Intergenic
1051501640 9:17784616-17784638 TTGTGAGCACCTTGAGGGCTGGG + Intronic
1052370344 9:27656949-27656971 CTGTGGCCAGGTTGGGGGCAGGG + Intergenic
1052736542 9:32348163-32348185 CTGTGTGAAAATTGGGGGCCAGG - Intergenic
1052998705 9:34565551-34565573 CTTAGGGCAGGTTGGGGGCTTGG + Intronic
1053311666 9:37024638-37024660 CTGGCAGCACAGTGGGGGCTGGG - Intronic
1058523048 9:105831113-105831135 CTGTTGGCAAATTGGGCACTTGG - Intergenic
1059790274 9:117635175-117635197 CTGTGTGCACCTTGAGGACTGGG + Intergenic
1060183743 9:121551442-121551464 CTGGGGGACCTTTGGGGGCTGGG - Intergenic
1060990666 9:127846885-127846907 CTGTGTGCACATGGGTGGCGAGG - Intronic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061825978 9:133258445-133258467 CTGTGGGCAGAGAGGAGGCTGGG + Intronic
1061855248 9:133438403-133438425 CTGTGGCCATCTTGGAGGCTGGG - Intronic
1062161455 9:135082620-135082642 GTGTGTGCATATTTGGGGCTGGG - Intronic
1062310545 9:135933546-135933568 CTGTGGGCTGAGTGGGGGCGTGG - Intronic
1062622258 9:137428418-137428440 CTGGGGGCACAGTGGAGGGTGGG - Intronic
1189369848 X:40418988-40419010 ATGTGGCCACTTTGGGGACTGGG + Intergenic
1190368299 X:49718166-49718188 CATTGGGGACATTGGGGACTGGG + Intergenic
1191160173 X:57321310-57321332 ATTAGGGCACATTGGGGGTTCGG + Intronic
1191210121 X:57875936-57875958 CTGTGGCCTCTCTGGGGGCTGGG - Intergenic
1193807117 X:86008251-86008273 CTGTCGGCAGGTGGGGGGCTGGG + Intronic
1194021539 X:88697256-88697278 CTGTTGGCAGGTTGGGGGCTAGG + Intergenic
1194123193 X:89985704-89985726 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1194157808 X:90415171-90415193 CTCTGGGCCCATTAGGTGCTGGG - Intergenic
1194507041 X:94745776-94745798 CTGTGTGCAGGTTGGGGGTTGGG + Intergenic
1194597535 X:95877307-95877329 ATGTCATCACATTGGGGGCTAGG + Intergenic
1195592975 X:106653683-106653705 CTGTCGGCATGTTGGGGGCTAGG - Intronic
1196036402 X:111149697-111149719 CTGTGTGCAGCTTAGGGGCTTGG - Intronic
1196179572 X:112675103-112675125 CTTTGGGGACTTTGGGGACTTGG + Intronic
1196547616 X:116981455-116981477 CTGTTGGCGGATGGGGGGCTAGG + Intergenic
1196561898 X:117159632-117159654 CTGTTGGGAGGTTGGGGGCTAGG + Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197398059 X:125952076-125952098 CTCTGGGCAAATTGAGAGCTGGG + Intergenic
1197796086 X:130299772-130299794 CTGCGGGGACACAGGGGGCTAGG + Intergenic
1198880777 X:141278716-141278738 CTGTGGGAAGATTAGGAGCTTGG - Intergenic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1200476054 Y:3643150-3643172 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1201634261 Y:16104818-16104840 CTGTGGGCCCATTCGTGGGTGGG - Intergenic