ID: 976803527

View in Genome Browser
Species Human (GRCh38)
Location 4:89020030-89020052
Sequence TCTTTGGCCCAAAAGCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 138}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976803524_976803527 10 Left 976803524 4:89019997-89020019 CCTTTTATGACAGTCATTAGTCA 0: 1
1: 0
2: 1
3: 8
4: 139
Right 976803527 4:89020030-89020052 TCTTTGGCCCAAAAGCATCAGGG 0: 1
1: 0
2: 2
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976803527 Original CRISPR TCTTTGGCCCAAAAGCATCA GGG Intronic
904248731 1:29206973-29206995 TCCTTGGCCAAGAAGCATCCAGG + Intronic
905742657 1:40386147-40386169 TATTTTGAACAAAAGCATCATGG - Intronic
909054618 1:70806866-70806888 TGATTGGCCGAAAGGCATCAAGG + Intergenic
912472679 1:109916370-109916392 TCCTTCTCCCAAAAACATCAGGG + Intronic
912706446 1:111918575-111918597 TCTGTGCCCCCAAAGCACCATGG - Intronic
912881836 1:113423662-113423684 CCATTGGCCAAAAGGCATCAAGG + Intronic
915003038 1:152611062-152611084 CCTGTGGCCCAAAGACATCAAGG - Intergenic
915963121 1:160283556-160283578 TCTGGGGCCCCGAAGCATCAGGG + Exonic
916323831 1:163534985-163535007 TCTGTGGCACAATAGCATCATGG - Intergenic
921035328 1:211372476-211372498 ACTCTGGTCCAGAAGCATCAGGG - Exonic
921510421 1:216021558-216021580 TCTTGGGACCAAAATCTTCAGGG - Intronic
922274708 1:224066616-224066638 TCTTTGTCCCAAAAGCCAGATGG + Intergenic
1067662832 10:48249406-48249428 TCTGTGGCCCAAGAGTCTCAAGG + Intronic
1068716645 10:60196169-60196191 TCCTTGGTCCAAAAGCAGAAGGG + Exonic
1069882512 10:71602604-71602626 TCTTTGTCCCACAAACTTCAGGG + Intronic
1071781628 10:88852719-88852741 TCATTGGCCCAAAAGATCCAGGG + Intergenic
1074996376 10:118760479-118760501 GCGCTGGCCCACAAGCATCACGG + Intergenic
1075754403 10:124799665-124799687 TGTTTGGCCAAGAAGCAACATGG + Intergenic
1077251638 11:1563385-1563407 CCTGTGGCCCAAAAGCAGCCTGG - Intronic
1079314216 11:19394183-19394205 CCATTGGGCCAAAAGCATCCAGG - Intronic
1079547827 11:21656509-21656531 TCTGTGGCCTAAAACCATGAAGG + Intergenic
1080123097 11:28699981-28700003 TCTTTGGTCAAAAAGCTTCTAGG + Intergenic
1081391474 11:42534506-42534528 TCTCTGCTCCAAAAGCAACAGGG + Intergenic
1084514980 11:69632546-69632568 TCCTTACCCCAGAAGCATCATGG - Intergenic
1085633646 11:78140685-78140707 TTTTTAGACCAAAAGCATCTTGG - Intergenic
1089940269 11:122409396-122409418 TGTTCGGTCCAAAACCATCAGGG + Intergenic
1091017318 11:132063711-132063733 TCTTTGGCTCAAGAGCAGTAAGG + Intronic
1092510664 12:9152775-9152797 TCTTTGGCCCAAAAGCAACTTGG - Intronic
1092842825 12:12559981-12560003 TCTTTGGGCCAAAAGCTTAATGG - Intronic
1093800025 12:23361918-23361940 CTGTTGCCCCAAAAGCATCATGG + Intergenic
1094738077 12:33258391-33258413 ACTTTGGCCCATAAGCATTTTGG + Intergenic
1096602978 12:52743359-52743381 ACCTTGGCCCAAAAACCTCAAGG + Intergenic
1102406129 12:112675944-112675966 TCTCTGTCCCACAAGCCTCAGGG - Intronic
1106167317 13:27259785-27259807 TCTTTGGCATAAGAGGATCATGG - Intergenic
1108470412 13:50761674-50761696 TCATTGCCCCAAATGAATCATGG + Intronic
1110730795 13:78876842-78876864 TTATTGGCCAAAAGGCATCAAGG + Intergenic
1114061550 14:19021919-19021941 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
1118296262 14:64572748-64572770 GCATTGGCCTAAAAGCTTCAAGG + Intronic
1118598455 14:67454047-67454069 TCTTTGGGTTAAAAGCCTCACGG + Intronic
1120422156 14:84302218-84302240 TATTTGGCTAAAAGGCATCAAGG - Intergenic
1125612949 15:40984719-40984741 TCTTCGGCCCATTAGGATCAGGG - Intronic
1125769831 15:42157757-42157779 TCTGTGGACCACAACCATCAAGG + Intergenic
1128982723 15:72198544-72198566 CCTTTGGCACTACAGCATCATGG + Intergenic
1130325459 15:82876008-82876030 TCCTTGGCCTAAAAGAATGAGGG + Intronic
1131825384 15:96318200-96318222 TCTTTGTACCAAAAGCAAAAAGG + Intergenic
1132222225 15:100113533-100113555 TATGTGGCCCAAAAGGATCTGGG + Intronic
1137060685 16:35789784-35789806 TCTTAGGCCCAAGAGGAACATGG + Intergenic
1137697760 16:50473736-50473758 TCATTGGCCAAATAGCATCCAGG + Intergenic
1137899848 16:52255638-52255660 TCTTTCACCCAAAGTCATCATGG + Intergenic
1138921544 16:61536066-61536088 TCTTTGCCCCAAAAGGATGGAGG - Intergenic
1140779523 16:78282024-78282046 CCCTTGGCCCAAAAGCCACAGGG + Intronic
1142336676 16:89493826-89493848 TCCTTGGCCTAATAGCAGCAGGG + Intronic
1144246887 17:13375284-13375306 TCTTTTGTCCAATAGTATCAAGG - Intergenic
1150641834 17:66954492-66954514 TCTTGGGTCCAAAGGCATCATGG + Intergenic
1154453075 18:14495481-14495503 TCTGTGGCAAAAAAGCATCTGGG + Intergenic
1155324738 18:24654370-24654392 TATTTGACCTAAAAGAATCAAGG + Intergenic
1157922092 18:51723677-51723699 TCTTTATCCCAAAATCTTCAGGG - Intergenic
1159661434 18:71100393-71100415 TCTTTGGAACATAATCATCAAGG - Intergenic
925020526 2:564476-564498 TTTTTGGCACAAAAACAACATGG - Intergenic
925055179 2:851713-851735 TTTTTGGCTCCTAAGCATCATGG + Intergenic
925058783 2:875377-875399 TTTTTGGCTCCTAAGCATCACGG - Intergenic
927152892 2:20205825-20205847 TCTTTGGCCCCAAAGCTCCCTGG - Intronic
927868137 2:26606118-26606140 TCCTTGCCGCAAATGCATCAGGG + Intronic
932924936 2:75962280-75962302 TGTTTGGCACATAAGCATTAAGG - Intergenic
937020088 2:118642403-118642425 TCTCTGACCCAGAAACATCAAGG + Intergenic
937120416 2:119436890-119436912 CCTTTGGCCCAAAGGCCTCTGGG - Exonic
937399922 2:121573450-121573472 TATTTGGCCCAAAAGTATCATGG + Intronic
938478908 2:131642227-131642249 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
944004928 2:194892854-194892876 TCTTTTGCCCAAAAGGATAAAGG + Intergenic
946108581 2:217393776-217393798 TCTCTGGCCCTAAATCTTCAGGG - Intronic
946369940 2:219274613-219274635 ACTTTGGCTCAGAATCATCAGGG - Intronic
1173740104 20:45394350-45394372 TGATTGGCCAAAAGGCATCAAGG - Intronic
1174821976 20:53734207-53734229 TCTTTGTCCCAAGAGCAGCAAGG + Intergenic
1175192994 20:57224003-57224025 TTTATGGACCAAAATCATCACGG + Intronic
1175855088 20:62116783-62116805 TCTCTGGCCCAAATGCAGCAAGG + Intergenic
1175915449 20:62423811-62423833 TCTTCTCCCCAAAAGCACCAAGG - Intronic
1180480038 22:15744519-15744541 TCTGTGGCAAAAAAGCATCTGGG - Intergenic
1182170400 22:28222940-28222962 TCTTTGGCCTAAAACAATGAAGG + Intronic
1183326405 22:37197019-37197041 TCTTTGGCCCAAAGGTCACATGG + Intronic
950979897 3:17291208-17291230 TGTTTGGCTCAAAAGTAGCAAGG + Intronic
951566843 3:24019839-24019861 TGATTGGCCAAAAGGCATCATGG + Intergenic
955908359 3:63831714-63831736 TCTTTGGGCCAGTAGCTTCATGG - Exonic
956529235 3:70199519-70199541 TCTCTTGCCCAAAAACAACATGG + Intergenic
956913776 3:73849402-73849424 TCTTTGGCTAAGAAGCATCATGG + Intergenic
960945782 3:122965565-122965587 TCACTGGCTCAACAGCATCAAGG - Intronic
963366067 3:144336234-144336256 ACTTTGGTTCAAAAGCAGCAGGG + Intergenic
965056446 3:163722519-163722541 TGATTGGCTAAAAAGCATCAAGG + Intergenic
969389609 4:6881568-6881590 TCTTTTCCCCTAAAGTATCACGG + Exonic
971087422 4:23295061-23295083 TCTTTTCCCAAAAAGCTTCATGG - Intergenic
973646471 4:52955793-52955815 TCTTTGTCCCAAAGTCATCATGG - Intronic
975303024 4:72813620-72813642 TCTCTGGCCCAACAGATTCAAGG + Intergenic
976803527 4:89020030-89020052 TCTTTGGCCCAAAAGCATCAGGG + Intronic
978061468 4:104345008-104345030 TGATTGGCCAAAAGGCATCAAGG - Intergenic
978650504 4:110998310-110998332 TCTTGGGTCCAGAAGCATCCCGG + Intergenic
980486130 4:133460059-133460081 TCTATTACCCAATAGCATCATGG + Intergenic
981908736 4:149953646-149953668 TCTGCTGCCCAAATGCATCAAGG - Intergenic
982575790 4:157108302-157108324 TATTTGGCCCAGATCCATCAGGG - Intronic
983606384 4:169590655-169590677 TTTTTGGCCCAAAACAATGAAGG + Intronic
984250185 4:177322559-177322581 ACTTTGGACCAAAAGCTTTACGG + Exonic
984989209 4:185361990-185362012 CATTTGGCCAAAAAGCATCCCGG - Exonic
987840363 5:23216009-23216031 TCTTTGTCATAAAAGTATCATGG + Intergenic
988998053 5:36733254-36733276 TTTTTGTCCCCAAAGAATCAGGG + Intergenic
989610981 5:43291258-43291280 TCTTTCCCCCACAAGAATCATGG + Intronic
990753315 5:59040448-59040470 TCCTTGGCCCAAGATCATCTAGG - Intronic
990988863 5:61665834-61665856 TCTACTGCCCAGAAGCATCATGG + Intronic
994239714 5:97406706-97406728 TGATTGGCCAAAAGGCATCAAGG + Intergenic
995123819 5:108560415-108560437 TCTTTTGCCCAAATTCATAAAGG - Intergenic
995183191 5:109247863-109247885 GCTGTGGCCAAACAGCATCATGG + Intergenic
997835862 5:137193098-137193120 TCTTTGCCACACAAACATCAGGG - Intronic
997908099 5:137840632-137840654 TCTGTGGACCAGCAGCATCATGG + Intergenic
999206460 5:149851800-149851822 TCCTTGGCCCAGAACCACCATGG + Exonic
1005402536 6:25449415-25449437 TCTCTGCCCCAGAAGAATCATGG + Intronic
1005707980 6:28475414-28475436 TCTTTGCCACAAAAGCAATAAGG + Intergenic
1007793367 6:44327422-44327444 TCTTTGGCCCACCAGCTTCCAGG + Intronic
1007970847 6:46050675-46050697 TCTTTGCCACAAAAGAATCATGG + Intronic
1011496894 6:87945481-87945503 TCTTTTGCCTGAAAACATCAAGG + Intergenic
1012217277 6:96602784-96602806 ACTTTGGCCCTAAAGCCTGAAGG + Intronic
1013165982 6:107592494-107592516 TCATTAGACCAAAAGCATTAAGG - Intronic
1013327722 6:109064367-109064389 TATTTAGCTCCAAAGCATCATGG + Intronic
1021073897 7:16276562-16276584 TCTTTTGCTCAAAATCTTCAAGG - Intronic
1021700847 7:23318127-23318149 TCCTTGGCCCACTTGCATCAGGG + Intronic
1021804686 7:24343365-24343387 TATTTGTCCCAAAACCAGCAAGG - Intergenic
1028989999 7:97038703-97038725 TCTTAGGCTTAAAAACATCAAGG - Intergenic
1029180446 7:98697445-98697467 TCTTGAGTCCAAAAGCAGCAGGG + Intergenic
1030934938 7:115574094-115574116 TTCTTGGCCCAAAAGCTTAATGG + Intergenic
1032363105 7:131274228-131274250 TTCTTGGCCAAAAATCATCAAGG - Intronic
1033379715 7:140803415-140803437 TCTATGGTCCAAAAACATAATGG + Intronic
1033562422 7:142545131-142545153 TCTATGGGCCAATAGCCTCATGG + Intergenic
1033769558 7:144534330-144534352 TCTTTGTCTAAAAAGGATCATGG - Intronic
1034850973 7:154493226-154493248 TGCTTGACCCAAAAGCACCAAGG - Intronic
1038216102 8:25562915-25562937 TCTCTGGCCAAACAGCCTCAAGG - Intergenic
1038654357 8:29435704-29435726 TCAATGGCCCAAGAGTATCAGGG + Intergenic
1038840526 8:31180668-31180690 TCTTGGCCCCCAAAGAATCAAGG + Intergenic
1046519942 8:115311128-115311150 TCTTTCCACCAAAAGCAACAAGG + Intergenic
1046667201 8:117017501-117017523 TTTTTGGCCCAATAGAAGCAAGG + Intronic
1046736612 8:117782811-117782833 TCCATGACCCAAAAGGATCATGG + Intergenic
1047837774 8:128713010-128713032 TCTATTGCTCAAAAGCAACAAGG + Intergenic
1050596580 9:7210653-7210675 TATTTGGCTTAAAAGAATCATGG + Intergenic
1051362317 9:16292085-16292107 ACTTTGGCACAAAAGCATACTGG + Intergenic
1051846362 9:21455593-21455615 CATTTGGCCCAAAAGCACCAAGG - Intergenic
1052818505 9:33120640-33120662 TGTTTGGCCCAAAGGCTTTAAGG - Intronic
1054848843 9:69825546-69825568 TCTCTGGCTCAGAAGCATCAAGG - Intronic
1062072838 9:134567288-134567310 TGTTTGGGCCAATAGCATCTGGG - Intergenic
1062234905 9:135503116-135503138 GCTCTGGGCCAAAAGCATTAAGG - Intronic
1185992070 X:4902396-4902418 GCTTTGCCCCAAAAGCAGCCAGG + Intergenic
1191662706 X:63667492-63667514 CCTTTCACCCAAAAGCTTCAAGG + Intronic
1191901016 X:66040513-66040535 TCTTAAGCCCAAAAGCACCCCGG - Intergenic
1192249910 X:69403397-69403419 TCTGTGGCCCAAAATAACCAAGG - Intergenic
1192774716 X:74231318-74231340 TATTTAGCCCAAAAGTATTATGG - Intergenic
1199029618 X:142981467-142981489 TATTTGGAACAAAAGCATCTGGG - Intergenic
1199370469 X:147042220-147042242 GCTGTGGCGAAAAAGCATCAAGG + Intergenic
1201343300 Y:12956594-12956616 ACTTTGGCTCACAAGCATCCTGG - Intergenic