ID: 976811566

View in Genome Browser
Species Human (GRCh38)
Location 4:89105642-89105664
Sequence TTGAGCCAGAGCATCTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 192}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976811566_976811569 -5 Left 976811566 4:89105642-89105664 CCCAGATAGATGCTCTGGCTCAA 0: 1
1: 0
2: 1
3: 7
4: 192
Right 976811569 4:89105660-89105682 CTCAAGGACTACTTACAGACAGG 0: 1
1: 2
2: 10
3: 10
4: 70
976811566_976811571 27 Left 976811566 4:89105642-89105664 CCCAGATAGATGCTCTGGCTCAA 0: 1
1: 0
2: 1
3: 7
4: 192
Right 976811571 4:89105692-89105714 AGAGCCTTTTGTGTTTGATTAGG 0: 4
1: 9
2: 20
3: 33
4: 292
976811566_976811572 28 Left 976811566 4:89105642-89105664 CCCAGATAGATGCTCTGGCTCAA 0: 1
1: 0
2: 1
3: 7
4: 192
Right 976811572 4:89105693-89105715 GAGCCTTTTGTGTTTGATTAGGG 0: 4
1: 10
2: 20
3: 17
4: 267
976811566_976811570 1 Left 976811566 4:89105642-89105664 CCCAGATAGATGCTCTGGCTCAA 0: 1
1: 0
2: 1
3: 7
4: 192
Right 976811570 4:89105666-89105688 GACTACTTACAGACAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976811566 Original CRISPR TTGAGCCAGAGCATCTATCT GGG (reversed) Intronic
903321925 1:22548497-22548519 TTCAGGCAGGGCATCTATCCTGG + Intergenic
904290287 1:29480865-29480887 TTAATCCACAGCAACTATCTTGG - Intergenic
904789070 1:33004801-33004823 CTGAGCCAGAGCTGCTAGCTTGG + Intergenic
904881677 1:33702763-33702785 ATGTGCCAGAGCATATATTTTGG - Intronic
905291685 1:36925971-36925993 TTGATCTAGAGCATCAACCTTGG - Intronic
906019801 1:42617716-42617738 ATGAGCCAGTTTATCTATCTAGG + Intronic
913343360 1:117782292-117782314 TTGAGCCAGAGGATAAACCTGGG + Intergenic
915642011 1:157235047-157235069 TTGAGCCAGATTATCAGTCTGGG - Intergenic
915787219 1:158626948-158626970 TTCATTCAGAGCCTCTATCTTGG + Exonic
916009195 1:160689320-160689342 TTCTGCAGGAGCATCTATCTAGG + Intronic
916657291 1:166887443-166887465 TTGAGCCATAGCAAACATCTTGG - Intergenic
917557274 1:176102817-176102839 ATGAGCCAGTTAATCTATCTGGG - Intronic
919828029 1:201517848-201517870 TTGAGCCAGATTACCGATCTGGG - Intergenic
920927846 1:210359482-210359504 ATGAGCCAGTTCATCGATCTGGG - Intronic
924760366 1:246979152-246979174 TTCACCCAGAGCAGCTCTCTAGG - Intronic
1062804448 10:406884-406906 TTGAGCCAGATGACCTGTCTGGG - Intronic
1063097877 10:2923946-2923968 CTGAGCCAGGGCATCAACCTGGG + Intergenic
1065679567 10:28215001-28215023 TTGAGCCAGATTACCTGTCTGGG - Intronic
1066174842 10:32892625-32892647 TTGTGTCAGAGCTTCCATCTAGG + Intergenic
1067469265 10:46524201-46524223 TTGAGCCAGAGTACCGGTCTGGG + Intergenic
1067662800 10:48249205-48249227 TAGAGACAGAGCTTCCATCTGGG + Intronic
1069696583 10:70390793-70390815 TTGAGCCAGACTACCTGTCTGGG - Intergenic
1070379898 10:75871373-75871395 TTGAGCCAGTGCCTCCATCAGGG + Intronic
1071257329 10:83882785-83882807 TTTAGCCAGATCCTCTATGTTGG + Intergenic
1074262515 10:111868693-111868715 TTGAGCTAGATTATCTGTCTGGG + Intergenic
1075213922 10:120515491-120515513 CTGAGCCAGAGACTCTGTCTAGG - Intronic
1080084141 11:28258485-28258507 TTGATCCAGAGGTGCTATCTAGG + Intronic
1081605045 11:44521806-44521828 TTGAGCCAGAGTACCCATCAGGG - Intergenic
1083142216 11:60731328-60731350 TTAAGTCAGAGCAAATATCTGGG + Intronic
1083280709 11:61625689-61625711 TCGAGCAGGAGCAGCTATCTTGG - Intergenic
1084137051 11:67192460-67192482 TTGAGATGGAGCATCTCTCTTGG + Intronic
1084573029 11:69970866-69970888 TTGAGCCCAAGCAGCCATCTTGG - Intergenic
1084852866 11:71957453-71957475 TTGCACCAAATCATCTATCTGGG + Intronic
1086236845 11:84641658-84641680 TTGAGCCAGAGTTTTTAACTGGG - Intronic
1086599771 11:88618449-88618471 ATGAGCCAGAGTTTCTCTCTAGG - Intronic
1088769044 11:113014878-113014900 TGGATCCAGAGCTGCTATCTGGG + Intronic
1090319004 11:125824824-125824846 TTAACCCAAAGCATTTATCTGGG - Intergenic
1092362298 12:7847232-7847254 TTGAGACAGAGTTTCTCTCTTGG - Intronic
1092687611 12:11069197-11069219 TTGAGCCACAGCATCCAACCTGG + Intronic
1093760602 12:22904706-22904728 GTGAGGCAGAGCTACTATCTAGG - Intergenic
1098689813 12:73472822-73472844 TTCAGACAGAGCATCAATTTGGG + Intergenic
1099154860 12:79161733-79161755 TTGAGCCTGAGGCTCTTTCTTGG + Intronic
1099644845 12:85339275-85339297 TTGTGCCAGAGGATCAATGTAGG + Intergenic
1103825343 12:123733293-123733315 TTGAGACAGAGTCTCTCTCTTGG - Intronic
1103995916 12:124829974-124829996 TGGAGCTAGAGCAGCCATCTTGG + Intronic
1104331933 12:127855185-127855207 ATCAGCCAGAGCAGCTATCAGGG + Intergenic
1104702947 12:130921083-130921105 TGGAGCTAGAGGGTCTATCTTGG + Intergenic
1106295703 13:28411772-28411794 TTGAGCCAGAGCCATTGTCTGGG + Intronic
1106630294 13:31465144-31465166 TGCAGGCCGAGCATCTATCTAGG - Intergenic
1112200856 13:97273150-97273172 TTGAGGTTGAGCATCTACCTTGG + Intronic
1112592526 13:100776736-100776758 ATGAGCCAGTTCATCAATCTGGG - Intergenic
1113848252 13:113404281-113404303 CTGACCCTGAGCCTCTATCTGGG + Intergenic
1115534266 14:34357881-34357903 TTGAGCCAGATTATTGATCTGGG + Intronic
1119554038 14:75539945-75539967 TGGAGCCTGAACATATATCTGGG + Intronic
1120268077 14:82276488-82276510 TTGAGCCAGATTACCCATCTTGG + Intergenic
1120401774 14:84041484-84041506 TTGAGCCAGATTACCTATCTCGG + Intergenic
1128559600 15:68655949-68655971 TTGAAACAGAGCATCTCCCTGGG + Intronic
1130612629 15:85375350-85375372 CTGATACAGAGCCTCTATCTAGG - Intergenic
1130887947 15:88109602-88109624 TTCTGCCAGAGCACATATCTTGG - Intronic
1131096781 15:89660505-89660527 TGGAGCTGGAGCAGCTATCTTGG + Intergenic
1134455240 16:14390608-14390630 TTGAGCCGGAGCCTCAAACTTGG + Intergenic
1135275034 16:21104950-21104972 TGGAACGAGAGCATCAATCTGGG - Intronic
1135645723 16:24160103-24160125 TTGAGCCATTTCATCTTTCTGGG - Intronic
1137452508 16:48590171-48590193 TTGAGCCAGAATATGGATCTGGG - Intronic
1138760206 16:59534381-59534403 TTGAGCCAGATTATGTGTCTTGG - Intergenic
1138874161 16:60928753-60928775 GTGAACCAGAGCATCCAACTTGG - Intergenic
1139133524 16:64174832-64174854 TGGAGCCAGAACATTTTTCTTGG - Intergenic
1139316118 16:66070522-66070544 TCGAGCCAGAGCACCCAGCTAGG - Intergenic
1141175622 16:81717001-81717023 TTGAGCCAGATTACCTGTCTGGG + Intergenic
1141903896 16:87010082-87010104 TTGAGGCAGTGAACCTATCTTGG + Intergenic
1143514519 17:7413165-7413187 TTCCGCCAGAGCTTCTATGTGGG - Intronic
1144797454 17:17901899-17901921 GTGAGCCAGAGCACCCAGCTGGG - Intronic
1146550516 17:33776760-33776782 TTTAGGCAGAGCACCTAGCTGGG + Intronic
1148633607 17:49130779-49130801 TCAACCCAGAGCATATATCTTGG - Intergenic
1150617831 17:66785702-66785724 TTAAGACAGAGCAACTCTCTTGG - Intronic
1151138451 17:71969856-71969878 TTGAGAAAGAGAATCTATCAAGG + Intergenic
1152641483 17:81451188-81451210 TTGAGCCACAGCATTCAACTCGG + Intronic
1156059712 18:33059223-33059245 TGGAGGCAGAACATCTATTTAGG + Intronic
1156301565 18:35840950-35840972 TTGAGCCAGATTACCAATCTGGG - Intergenic
1158509211 18:58075595-58075617 GTGAGCCACTGCATCTAGCTGGG + Intronic
1159093071 18:63871260-63871282 TTGAGACAGAGTTTCTCTCTTGG + Intergenic
1160957523 19:1700323-1700345 TGGAAACAGAGCATCCATCTGGG - Intergenic
1161726159 19:5930320-5930342 TTGAGCCAGAACATCTACTGGGG + Intronic
1163929032 19:20370909-20370931 TTCAGCCAGAGACTCTACCTGGG - Intergenic
1165362562 19:35345821-35345843 ATGAGGCAGAGCATGTATCAGGG - Intronic
1166860221 19:45805901-45805923 TGGAGCCACAGCAGCTATCTTGG + Intronic
925761065 2:7184882-7184904 TTGCACCAGAGCATCTAACTCGG + Intergenic
927060919 2:19418676-19418698 TTCAGCCATAGCATCTATGCAGG - Intergenic
927475651 2:23412478-23412500 TTGAACCAGTGCATCTAAATGGG + Intronic
928265492 2:29808016-29808038 TTTGGCCAAAGCATCTATCAAGG + Intronic
929094253 2:38248614-38248636 TTGAGACAGAGGAATTATCTAGG - Intergenic
929511215 2:42567918-42567940 TAGAGCCAGGGCCTCCATCTGGG + Intronic
933996285 2:87672354-87672376 CTGAGTCTGAGCATCCATCTAGG + Intergenic
937184822 2:120030409-120030431 TTGAGCCAGATTACCGATCTGGG - Intronic
937226805 2:120374980-120375002 TTGAGACAGCCCATCTCTCTTGG - Intergenic
937689046 2:124733581-124733603 TTGAGGAAGAACATCTGTCTAGG + Intronic
939663201 2:144916714-144916736 TTGATCCAGGGGATCTATTTTGG + Intergenic
940853005 2:158705885-158705907 ATGAGCCAGTTTATCTATCTGGG + Intergenic
945392357 2:209279582-209279604 TTGAGCCAGATTACCCATCTGGG - Intergenic
945936689 2:215909560-215909582 TTGAGCCAGATTACCAATCTGGG - Intergenic
946279078 2:218653256-218653278 TTGAGACAGAGTCTCTCTCTTGG - Intronic
949073403 2:242040226-242040248 TTCAGCCAGGGCCACTATCTGGG - Intergenic
1171049059 20:21838664-21838686 TTGAGCGGGAGTGTCTATCTGGG + Intergenic
1174702798 20:52625976-52625998 TTGAGCCATAACATGTATTTGGG + Intergenic
1176708656 21:10132631-10132653 TGGAGCCTGGGCGTCTATCTAGG - Intergenic
1177115128 21:17075848-17075870 TTGAGTCAGCAAATCTATCTAGG + Intergenic
1177638146 21:23812326-23812348 TGGAGCAATAGCATCTCTCTAGG + Intergenic
1177885422 21:26740682-26740704 TTCAGCCAGAGCTCCTATTTGGG - Intergenic
1178833295 21:36074374-36074396 TTGAGACAGAGTCTCAATCTTGG + Intronic
1179099224 21:38341948-38341970 TTGAGCCAGAGGACATATATGGG + Intergenic
1181411202 22:22721036-22721058 TGGAGCCAGAGAATCGGTCTGGG - Intergenic
1181413154 22:22739073-22739095 TGGAGCCAGAGAATCGGTCTGGG - Intronic
1181422622 22:22812162-22812184 TGGAGCCAGAGAATCTCTCAGGG - Intronic
1181721211 22:24775927-24775949 TTGAGCCAGATTATCAGTCTGGG + Intergenic
1182002254 22:26929229-26929251 TTTAGAAAGAGGATCTATCTAGG + Intergenic
1182481341 22:30610954-30610976 TTGAACCCCAGCATCTATGTGGG + Exonic
950905749 3:16536353-16536375 TGGAGCTAGAGCAGCTATTTAGG + Intergenic
951541955 3:23790217-23790239 TTGAGCCACAGCACCTGCCTAGG - Intergenic
953745582 3:45571449-45571471 TTGAGCCAGATTACCTGTCTGGG - Intronic
955660730 3:61296020-61296042 TGGAGCTAGAGGAGCTATCTGGG + Intergenic
955694747 3:61624491-61624513 TTGAGCCACAGCATCCATTTTGG + Intronic
959234291 3:103698610-103698632 TTCAGCAAAGGCATCTATCTGGG + Intergenic
962563807 3:136636228-136636250 TTGAGACAGAGTTTCTTTCTTGG - Intronic
964941384 3:162160381-162160403 TTGAGACAGAGTTTCTCTCTTGG + Intergenic
965103772 3:164334913-164334935 TTCAGCCAGAGACTCTACCTGGG + Intergenic
966313621 3:178621858-178621880 TTGAGCCAGAGCATCCCTCTAGG - Intronic
966533895 3:181009562-181009584 ATGAGCCAGTTCATCCATCTGGG + Intergenic
967433447 3:189416475-189416497 TTCACCCACAGCAACTATCTTGG - Intergenic
969969255 4:11028819-11028841 TTGGGCCAGAGCAGCTTTCCTGG - Intergenic
970440033 4:16072864-16072886 GTGAGCCAGTTTATCTATCTGGG - Intronic
971118424 4:23676595-23676617 TTGACCCAGAGAATCTCTGTGGG + Intergenic
971170310 4:24226785-24226807 TTGAGCCAGATCATCTGGCTGGG - Intergenic
971395571 4:26224132-26224154 CTGACACAGAACATCTATCTTGG + Intronic
971465963 4:26961222-26961244 TTTGGCCAGAGCCTCTGTCTTGG - Intronic
976811566 4:89105642-89105664 TTGAGCCAGAGCATCTATCTGGG - Intronic
979773944 4:124563743-124563765 ATGAGCCAGTTTATCTATCTGGG - Intergenic
980025554 4:127761866-127761888 CTGGGCCAGAGCCTCTTTCTTGG - Intronic
982433343 4:155349737-155349759 TAGAGACAGACCATCTAGCTAGG + Intronic
982867909 4:160541078-160541100 ATGAGCCAGTTCATCAATCTGGG + Intergenic
988982919 5:36589418-36589440 AAGAGCCAGAGCAACCATCTTGG + Intergenic
990447754 5:55908451-55908473 TCTATCCATAGCATCTATCTGGG - Intronic
992286639 5:75242254-75242276 TTGAGCCAGATTATCAGTCTGGG + Intergenic
992472240 5:77069464-77069486 TTGAGCCAGATTATCAGTCTGGG + Intergenic
992720187 5:79552995-79553017 TTGACCCAGTTCATCTATTTGGG - Intergenic
999509805 5:152237907-152237929 ATCAGCCAGAACATCGATCTTGG - Intergenic
999918903 5:156296030-156296052 GTGAGCCAGAGCATCTGTTGGGG + Intronic
1003775078 6:9351398-9351420 TTGAGCCAGATCAGATGTCTGGG - Intergenic
1004445441 6:15693540-15693562 ATGAGCCAGTGTATCCATCTGGG - Intergenic
1005840518 6:29742192-29742214 TGGAGCCAGGGCCTCTCTCTGGG - Intergenic
1006100820 6:31685148-31685170 TTTAGCCAGAGACTCCATCTAGG + Intergenic
1007885213 6:45220020-45220042 TTGAGACAGAGTCTCTCTCTCGG - Intronic
1011356930 6:86480694-86480716 TTCAGCCAGAGATTCTACCTAGG - Intergenic
1011513077 6:88122949-88122971 ATGAGCCAGTTTATCTATCTGGG - Intergenic
1014346366 6:120274179-120274201 TAGAGCCATAGCTTCTGTCTGGG - Intergenic
1020802732 7:12751351-12751373 ATGAGCCATAGCATCTCTTTGGG - Intergenic
1021031490 7:15742535-15742557 TTGGGCCAGAGCAATTATCCAGG + Intergenic
1021165155 7:17329706-17329728 TTGAGCAAGAGCATTCATGTTGG + Intronic
1021368890 7:19816738-19816760 TTGAGCTGCAGCAACTATCTTGG - Intergenic
1021465435 7:20937957-20937979 TTGAGCAAGAGCCTATTTCTTGG + Intergenic
1024253926 7:47525901-47525923 TGGAACCAGAGGATCAATCTGGG + Intronic
1026126677 7:67585664-67585686 TTGAGCCAGATTACCTGTCTTGG - Intergenic
1026139201 7:67690600-67690622 TTGAGCCAGATTACCTGTCTGGG - Intergenic
1026142884 7:67721309-67721331 TTGAGCCAGATTACCTGTCTGGG + Intergenic
1026496397 7:70907386-70907408 ATGAGCCAGTTCATCAATCTGGG - Intergenic
1029559502 7:101293189-101293211 TTGAGCCAGTTTATCCATCTGGG - Intergenic
1029634921 7:101777305-101777327 TTGAGACAGAGCCTTGATCTTGG - Intergenic
1030112795 7:106040919-106040941 TTCAGCAAGAGGATCCATCTGGG - Intergenic
1031968212 7:128043527-128043549 TTGTGCCACTGCATCTAGCTGGG + Intronic
1031969806 7:128055838-128055860 CTGGGCCAGAGCCTCTACCTCGG + Intronic
1032999160 7:137483919-137483941 TTTACCCAGAGCCACTATCTTGG - Intronic
1035133299 7:156675608-156675630 TCGAGCCTGACCATCTATTTTGG - Intronic
1035913801 8:3597263-3597285 GTGAGACAGAGCATCTCCCTGGG + Intronic
1038165065 8:25077840-25077862 TTGAGCCAGATTACCTGTCTGGG + Intergenic
1039618749 8:38977478-38977500 CTGAGTCAGCACATCTATCTGGG - Intronic
1042192785 8:66204818-66204840 GTGAGACAGAACAGCTATCTTGG + Intergenic
1042436581 8:68773222-68773244 TTGATCCAATACATCTATCTCGG - Intronic
1046981828 8:120344940-120344962 TTGAGACAGAGCACTTGTCTGGG + Intronic
1047908711 8:129501787-129501809 ATGTGCCAGAGCTTTTATCTAGG + Intergenic
1048178601 8:132175020-132175042 TTGCTCCAGAGCATCTCTCTGGG - Intronic
1049068062 8:140335038-140335060 TTGAGTCAAACCATCTTTCTAGG - Intronic
1049094992 8:140543398-140543420 TGGAGCAAGAGAATCTATCTGGG - Intronic
1053535044 9:38917009-38917031 TTTAGACATAGCATCCATCTGGG + Intergenic
1055527592 9:77151013-77151035 TTGTGCCAGAGCATTTACATAGG + Intergenic
1055851059 9:80630560-80630582 ATGAGCCAGTTAATCTATCTAGG - Intergenic
1056830978 9:89917210-89917232 TTGACTCAGAGCCTCTCTCTAGG + Intergenic
1058165584 9:101615405-101615427 TTGAGACAGAGTCTCGATCTCGG + Intronic
1058184307 9:101836390-101836412 TTGAGCTTGAGCAGCTATTTTGG - Intergenic
1058923310 9:109638949-109638971 TAGAGCCAGAGCAGCCAACTTGG + Intergenic
1061930368 9:133829395-133829417 TAGATCCAGAACATCTTTCTGGG - Intronic
1202793417 9_KI270719v1_random:101600-101622 TGGAGCCTGGGCGTCTATCTAGG - Intergenic
1186071568 X:5826556-5826578 TTGAGCCAGATTACCTGTCTGGG + Intergenic
1188495963 X:30783250-30783272 TTGAGCCAGATTATCAGTCTGGG - Intergenic
1188989455 X:36800114-36800136 TAGTGCCAGTGAATCTATCTTGG - Intergenic
1189509295 X:41645910-41645932 TTCTGCAGGAGCATCTATCTAGG - Intronic
1189784802 X:44549860-44549882 ATGAGCCAGTGTATCAATCTGGG - Intergenic
1193148611 X:78102892-78102914 TTGAGCCAGATTATCAGTCTGGG - Intronic
1193973937 X:88094041-88094063 ATGAGCCAGTGTATCAATCTGGG - Intergenic
1199932363 X:152536559-152536581 TTGATCCAGTGGTTCTATCTAGG - Intergenic
1200711083 Y:6485576-6485598 TTGAGGCATAGCATCTTTATAGG + Intergenic
1200744848 Y:6894828-6894850 TTCAGCCAGAGACTCTATTTGGG - Intergenic
1201022851 Y:9676410-9676432 TTGAGGCATAGCATCTTTATAGG - Intergenic