ID: 976812247

View in Genome Browser
Species Human (GRCh38)
Location 4:89110326-89110348
Sequence CTGTCATGCCAGATAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976812243_976812247 23 Left 976812243 4:89110280-89110302 CCAAAAGCCACTTACAACCTCAC 0: 1
1: 0
2: 0
3: 8
4: 190
Right 976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 236
976812244_976812247 16 Left 976812244 4:89110287-89110309 CCACTTACAACCTCACAACATAA 0: 1
1: 0
2: 1
3: 14
4: 151
Right 976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 236
976812245_976812247 6 Left 976812245 4:89110297-89110319 CCTCACAACATAACTAGATCAAA 0: 1
1: 0
2: 0
3: 19
4: 140
Right 976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976812247 Original CRISPR CTGTCATGCCAGATAGTGGA AGG Intronic
900362095 1:2294046-2294068 ATCTCATGTCAGATATTGGAAGG + Intronic
901557342 1:10042055-10042077 CTGTAATCCCAGATACTCGAGGG - Intronic
901609258 1:10484148-10484170 CTGTAATCCCAGCTACTGGAAGG - Intronic
904401788 1:30261694-30261716 CAGTCATGGCAGATAGTGAAGGG + Intergenic
904672207 1:32174244-32174266 CTTTCATGGCAGAGAGTTGATGG - Exonic
905542664 1:38772655-38772677 CTGTGATCCCAGGTAGTGGGTGG - Intergenic
905573532 1:39025477-39025499 CTGTAATCCCAGCTAGTGGGGGG - Intergenic
906451977 1:45958077-45958099 CTGTCAGGTTAGAGAGTGGAAGG + Intronic
907351257 1:53833280-53833302 CTGTAATCCCAGCTACTGGAAGG - Intronic
907427930 1:54392800-54392822 CTTTCATTCCAGAAAGGGGAAGG + Intronic
908860830 1:68486345-68486367 CAGTCATGGCAGAAGGTGGAGGG - Intronic
909192009 1:72565379-72565401 CTGTAATCCCAGCTACTGGAGGG - Intergenic
909940818 1:81609637-81609659 CATTCATGCAAGATTGTGGAGGG - Intronic
909953743 1:81752169-81752191 CTTTAATGCCACATGGTGGAAGG - Intronic
912414450 1:109498499-109498521 CTGGCAGGCCGGATTGTGGAGGG + Intronic
914335218 1:146708812-146708834 CTGTCATCCCAGCTAGTTGGAGG - Intergenic
916090102 1:161301298-161301320 CTGTAATGCCAGATACTCGGGGG + Intergenic
919242613 1:194934920-194934942 CAATCATGGCAGAAAGTGGAAGG - Intergenic
919973212 1:202594080-202594102 CTGATATGCCACGTAGTGGATGG - Exonic
920301582 1:204992265-204992287 CTTACATGCCAGGCAGTGGAGGG + Intronic
920368477 1:205461524-205461546 CTGTCATCCAGGAAAGTGGACGG - Intergenic
920377069 1:205514524-205514546 CTGGCCTGCCTGAAAGTGGAAGG + Intronic
922392530 1:225160128-225160150 CTGTCCAGCCAGATTGTGAAGGG - Intronic
922850252 1:228727013-228727035 CTGTAATGCAAGACAGTGTATGG - Intergenic
923899495 1:238310436-238310458 CTGTAATCCCAGATAGTCGGGGG - Intergenic
924440101 1:244078813-244078835 CTGTAATCCCAGCTACTGGAGGG - Intergenic
924633874 1:245766755-245766777 CTGTCATGTCAGTTAGCAGAAGG + Intronic
1065614704 10:27507918-27507940 CTGTCATGCCAGTTACTTGGGGG + Intronic
1066297533 10:34067799-34067821 CTGCCAAGCCAGATATGGGAGGG - Intergenic
1066434172 10:35381436-35381458 CTGTAATCCCAGCTACTGGAGGG + Intronic
1066649109 10:37638896-37638918 CTGTCTTGCCAGTTCCTGGATGG - Intergenic
1067516162 10:46946662-46946684 ATGTCATACCAGAAAGTAGAGGG - Exonic
1067646085 10:48105148-48105170 ATGTCATACCAGAAAGTAGAGGG + Intergenic
1068963586 10:62889430-62889452 CTGTCATGCCAGCTACTCGGGGG + Intronic
1069449138 10:68502071-68502093 CTGTAATCCCAGCTACTGGAGGG + Intronic
1071003011 10:80852380-80852402 CTTTCCTGGCAGATAGTGGGAGG + Intergenic
1071889808 10:89991533-89991555 CACTCATGACAGAAAGTGGAGGG + Intergenic
1072125263 10:92440074-92440096 CTGTCAAGCCAGATAGGTCAGGG - Intergenic
1072494666 10:95945026-95945048 CTCACATGGCAGATGGTGGAAGG - Intergenic
1074549826 10:114432344-114432366 CTCTCATGGAAGATGGTGGAAGG - Intronic
1076094055 10:127715974-127715996 CTTTAATGCCATCTAGTGGAAGG - Intergenic
1079578413 11:22031429-22031451 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1083054031 11:59802502-59802524 CTATGATGTCAGACAGTGGATGG + Exonic
1085670489 11:78459645-78459667 CAGTCATGGCAGAAAGTGAAAGG - Intronic
1087676690 11:101170872-101170894 CTGTGATGGCAGAGAGAGGAAGG + Intergenic
1087863629 11:103196051-103196073 CAGTGAAGCCAGATTGTGGAGGG + Intronic
1088101029 11:106155852-106155874 CTGTAATCCCAGTTACTGGAGGG - Intergenic
1089332099 11:117696737-117696759 ATGTGAAGCCAGATAATGGAAGG - Intronic
1089792472 11:120954705-120954727 CTGTGATGCTAGATGCTGGAGGG - Intronic
1092004848 12:5060715-5060737 CTGTTGTGCCAGCTAGTGCAAGG + Intergenic
1093395912 12:18682020-18682042 CTGTTTTGCCAGATAATGAATGG - Intergenic
1094336107 12:29356142-29356164 CTGTAATCCCAGATACTCGAGGG - Intronic
1096758606 12:53820691-53820713 CAGTCCTGCCAGATAAGGGAGGG - Intergenic
1097106223 12:56627342-56627364 CTGTAATTCCAGCTACTGGAGGG + Intronic
1097863034 12:64536874-64536896 CTGTTCTGCCAGGCAGTGGATGG - Intergenic
1102370684 12:112381035-112381057 ATGTCATCCCACAAAGTGGAAGG + Intronic
1102454832 12:113065033-113065055 CTGTGATGGGAGATAGGGGATGG + Intronic
1104309938 12:127645529-127645551 CTGTCATTCCAGGTACAGGATGG - Intergenic
1104550982 12:129757021-129757043 CTGTCATGGCAGATACTTGGGGG + Intronic
1104646612 12:130502086-130502108 CTGTCTTGCCTGATGGAGGAGGG + Intronic
1104722153 12:131050545-131050567 CAGTCATGGCAGAAGGTGGAGGG + Intronic
1106188403 13:27428355-27428377 CTGTCATTCCAGCCAGAGGAAGG - Intronic
1106820276 13:33456739-33456761 CTGTATTCCCACATAGTGGAAGG - Intergenic
1107992231 13:45828787-45828809 TTGTCATGCCTGATGGTGAAGGG + Intronic
1108320187 13:49281934-49281956 CTGTAATCCCAGATACTGGGGGG - Intronic
1108699562 13:52932473-52932495 CTGTCATGGCAGATAGTCTCAGG + Intergenic
1108699903 13:52934758-52934780 CTGTAATCCCAGCTACTGGAAGG + Intergenic
1112146819 13:96709206-96709228 CAGTCATGGCAGAAAGTGAAAGG - Intronic
1116114248 14:40628239-40628261 CTGTCTTGCCACATACTAGATGG - Intergenic
1116858832 14:49977693-49977715 CTCTCAGGCCAGATGCTGGATGG + Intergenic
1117249077 14:53917299-53917321 CTGTCATCCCAGCTAGTCAAAGG - Intergenic
1117695527 14:58358343-58358365 CTGTAATCCCAGATATTGGGAGG + Intronic
1117881712 14:60319102-60319124 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1120235530 14:81886276-81886298 ATCTCATGGCAGAAAGTGGAAGG - Intergenic
1120289008 14:82543067-82543089 CTGTCTTGCCAGGTAGTTAAGGG - Intergenic
1120813712 14:88831179-88831201 CTGTCATGGCAGCTGGTGGGAGG - Intronic
1121256579 14:92534754-92534776 CTCACATACAAGATAGTGGAAGG - Intronic
1121735382 14:96214354-96214376 CTGTCATTCCTGAGAGAGGACGG + Intronic
1124365842 15:29071041-29071063 CTGTCATTCCAGAGAGTGCTTGG + Intronic
1125348696 15:38745046-38745068 CTGTCATCACTGATAGTTGAAGG - Intergenic
1125750087 15:42021959-42021981 CTGGCCTTCCAGAAAGTGGAGGG + Intronic
1126766461 15:52015932-52015954 CTGTAATCCCAGCTACTGGAAGG + Intronic
1133871697 16:9694799-9694821 CAGTCATGGCAGAAAGTGAAGGG + Intergenic
1134096266 16:11420936-11420958 CTGTCATCCCAGAGGGTGGGTGG - Intronic
1135815331 16:25627416-25627438 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1137687866 16:50399417-50399439 CTGTAATGACAGATGGTGGAGGG + Intergenic
1138241519 16:55431186-55431208 CTGTAATCCCAGCTATTGGAAGG - Intronic
1139998407 16:71002427-71002449 CTGTCATCCCAGCTAGTTGGAGG + Intronic
1140809772 16:78566122-78566144 CTCTCATGGCAGAGAGAGGAAGG + Intronic
1141566427 16:84905519-84905541 CTGTAATCCCAGCTAGTTGAAGG - Intronic
1142302135 16:89265047-89265069 CTGTCTTGCCAGATGCTGCACGG + Intergenic
1143208160 17:5161319-5161341 CTGTAAGCCCAGATAGAGGATGG + Intronic
1143858615 17:9871570-9871592 CTGTCATCTCAGAAAGAGGAAGG - Intronic
1143901633 17:10178817-10178839 CTGTCACGGCAGACAGCGGAGGG + Intronic
1144365987 17:14545408-14545430 CTGTCATGCCAGATAAGAAAGGG - Intergenic
1144590736 17:16521437-16521459 CTGTCCTGCCATCTAGTGGTGGG + Intergenic
1146711993 17:35050122-35050144 CTGTAATGCCAGCTACTGGGTGG + Intronic
1148168053 17:45497574-45497596 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1148280764 17:46345383-46345405 CTGTAGTCCCAGATATTGGAGGG - Intronic
1148302992 17:46563318-46563340 CTGTAGTCCCAGATATTGGAGGG - Intronic
1149872241 17:60193117-60193139 CTGTAAGCCCAGATAGAGGATGG - Intronic
1150399237 17:64843990-64844012 CTGTAGTCCCAGATATTGGAGGG + Intergenic
1150857591 17:68767984-68768006 GGGTTATGCCAGATTGTGGAGGG + Intergenic
1151670570 17:75569679-75569701 CTGTAATCCCAGCTACTGGAAGG + Intronic
1154954115 18:21239025-21239047 CTGTTATGGGAGAGAGTGGAGGG + Intergenic
1155792638 18:29993706-29993728 CTGACATGTTAGAAAGTGGAGGG + Intergenic
1160818386 19:1046726-1046748 CAGTCGTGCCAGATGGTGGGCGG + Intronic
1161107232 19:2450324-2450346 ATGTCACGTGAGATAGTGGATGG + Intronic
1162603870 19:11692267-11692289 CTGGCCTGCCACATAGTGAAGGG - Intergenic
1162984749 19:14262477-14262499 CTGTAATCCCAGATACTTGAGGG - Intergenic
1163125241 19:15240924-15240946 CTGTGCTGACAGACAGTGGAAGG - Intronic
1164052372 19:21594282-21594304 GGGCCATGCCAGATAGTTGATGG - Intergenic
1164403625 19:27921741-27921763 CTGTAATGCCAGAAATTGGGAGG + Intergenic
1167514770 19:49916807-49916829 CTGTGATCCCAGATAGAGGTGGG + Intronic
1167579791 19:50334677-50334699 GTGACATGCCAGAGAGTGGTGGG - Intronic
1168704064 19:58458288-58458310 CTGTAATCCCAGCTACTGGAGGG - Intergenic
926381527 2:12295318-12295340 ATGTCATGCCAGATTCTGGGGGG - Intergenic
927328995 2:21840740-21840762 CAGTCATGGCAGATAGTAAAGGG - Intergenic
931200236 2:60090629-60090651 CTTTCATGCCAAAAGGTGGAAGG - Intergenic
931712474 2:65000775-65000797 ATGTCATGCAAGACATTGGAGGG + Intronic
937055410 2:118930907-118930929 CTCACATGGCAGATGGTGGAAGG + Intergenic
940515844 2:154683094-154683116 CTCCCATGGCAGATGGTGGATGG - Intergenic
944531876 2:200675123-200675145 CTGGAATGCCAGCTAGAGGATGG + Intronic
945139864 2:206673378-206673400 CTGTAATCCCAGCTACTGGAGGG - Intronic
945271935 2:207949416-207949438 CTGTAATCCCAGCTACTGGAAGG + Intronic
947161238 2:227217097-227217119 CAGTCATGGCAGATGGTGAAAGG + Intronic
947862442 2:233370334-233370356 CTGTAATGCCAGCTACTGGGGGG - Intronic
948414933 2:237796259-237796281 CTGTAATCCCAGCTACTGGAAGG + Intronic
1170476367 20:16718906-16718928 CTCTCATGTCAGACAGTGGCTGG - Intergenic
1172545363 20:35756789-35756811 CTGTAATCCCAGCTACTGGAGGG - Intergenic
1173456489 20:43206573-43206595 CAATCATGGCAGAAAGTGGAGGG + Intergenic
1173480522 20:43395153-43395175 CTGTAATCCCAGATACTTGAGGG + Intergenic
1174163175 20:48565979-48566001 GTGTCATGTCAGATAGTGGTGGG + Intergenic
1176272825 20:64245320-64245342 CTGTGATGCCAGTTACTGGGAGG - Intergenic
1176943993 21:14956538-14956560 CTGTAATCCCAGCTACTGGAGGG + Intergenic
1178625048 21:34209091-34209113 CAGTCATGGCAGAAAGTGAAGGG - Intergenic
1179766218 21:43574953-43574975 CTGTCAGGCCTGGGAGTGGAAGG - Intronic
1181555500 22:23669326-23669348 CTGTAATCCCAGCTGGTGGAAGG + Intergenic
1182447435 22:30397797-30397819 CTGGGATGCAAGATAGGGGACGG - Intronic
1184393699 22:44220218-44220240 CTGTAATCCCAGCTAGTTGAAGG - Intergenic
1185261373 22:49866203-49866225 TTGTCAAGCCACATAGTGAAAGG - Intronic
949197939 3:1335911-1335933 CTGTGGTGCCAGCTAATGGATGG + Intronic
950365536 3:12480857-12480879 CTGTCATGCTGGATACAGGAGGG - Intergenic
950795884 3:15510583-15510605 CTGTAATCCCAGCTACTGGAAGG + Intronic
950886042 3:16363757-16363779 CTGTTATGCCAGCTAGTCCAGGG - Intronic
950958055 3:17076193-17076215 TTGTCATTCCAGTAAGTGGATGG + Intronic
951351796 3:21615283-21615305 CAATCATGGCAGATGGTGGAGGG - Intronic
952233810 3:31458456-31458478 CTGTAATCCCAGATACTGGCTGG + Intergenic
953489629 3:43337700-43337722 CAGTCATGGCAGAAAGTGAAGGG + Intronic
953560373 3:43985444-43985466 CACTCATGACAGAAAGTGGAAGG - Intergenic
953682515 3:45050592-45050614 CTGTCATGGCAGAAGGTGAAGGG - Intergenic
954993289 3:54859584-54859606 CTATCATGCTACATAATGGAGGG - Intronic
956041156 3:65146489-65146511 CTGTCATGCAACATAATGGTGGG - Intergenic
956826848 3:73005063-73005085 CTGTAATGCCAGCTACTGGGAGG - Intronic
957924273 3:86788607-86788629 CTGTAATCCCAGCTACTGGAGGG - Intergenic
958457529 3:94350032-94350054 CTGGGATGCAAGATAGTTGAGGG - Intergenic
959573261 3:107908271-107908293 CTGACCTTCCAGATATTGGAAGG - Intergenic
961752693 3:129106576-129106598 CTGTCTGGCCAGATGGTGGCAGG - Intronic
963069362 3:141290273-141290295 CTGTAATGCCAGATACTGCAGGG + Intronic
963423085 3:145087225-145087247 CTCACATGACAGAAAGTGGAAGG + Intergenic
964065796 3:152577294-152577316 CTGTAATCCCAGCTACTGGAGGG + Intergenic
964091301 3:152879226-152879248 CAGTCATGGCGGAAAGTGGAGGG - Intergenic
964372085 3:156011015-156011037 CTGTGATGCCTGACACTGGATGG + Intergenic
965191717 3:165538892-165538914 CTGTAATCCCAGAAATTGGAAGG - Intergenic
966941561 3:184751162-184751184 CTTTCATGCCAGATGGTGACTGG - Intergenic
969366339 4:6696688-6696710 ATGTCATGCCAGATAGCTGAAGG + Intronic
969953030 4:10858800-10858822 CTCTCATAGCAGAAAGTGGAAGG - Intergenic
970866247 4:20762192-20762214 CTGTGTTCCCACATAGTGGAAGG + Intronic
971255649 4:25011192-25011214 CTGACATGGAAGATAGGGGAGGG - Intronic
972012325 4:34200593-34200615 ATGTCAAGCCAGGTAGTGTATGG + Intergenic
974610630 4:64210771-64210793 CTGTAATCCCAGCTAGTGGGAGG - Intergenic
976073584 4:81271362-81271384 CTGTAATCCCAGCTAGTTGAGGG + Intergenic
976812247 4:89110326-89110348 CTGTCATGCCAGATAGTGGAAGG + Intronic
977183438 4:93905887-93905909 CTGTAATCCCAGATATTGGTAGG - Intergenic
979126798 4:116982905-116982927 CTCTCATGGCAGAAAGTGAAAGG + Intergenic
984298219 4:177881280-177881302 CTGTCTTTCCAGTTTGTGGAGGG + Intronic
989989249 5:50741929-50741951 CTGTAATGCCAGCTAGTAGAAGG - Intronic
990148436 5:52788519-52788541 CTGGAATGCCCGAAAGTGGATGG - Intronic
992516546 5:77499603-77499625 CTCTGGTGCCAGTTAGTGGAAGG - Intronic
992782674 5:80142353-80142375 CTGTAATGCCAGCTACTCGAAGG - Exonic
993342511 5:86741750-86741772 CTGTCTTTAAAGATAGTGGAAGG + Intergenic
993787427 5:92160382-92160404 CTATCATGGCAGAAAGTGAAGGG - Intergenic
995176725 5:109186543-109186565 CTGTCATGCCAGACAGGGAAAGG - Intronic
996392796 5:122980711-122980733 CTGTCACACTAGATACTGGAAGG - Intronic
998400533 5:141846509-141846531 CTGTAATGGCAGATTCTGGAGGG + Intergenic
998480338 5:142457968-142457990 CAATCATGGCAGAAAGTGGAGGG - Intergenic
999255633 5:150208713-150208735 CTGTCATGCCAGGGAGAAGAGGG - Intronic
1000035934 5:157447896-157447918 CTGTTATGCCATATTATGGAGGG - Intronic
1001628396 5:173156304-173156326 CTGTAATGCTACATTGTGGATGG - Intronic
1006291871 6:33144102-33144124 CTGTAATCCCAGATACTCGAGGG + Intergenic
1008266028 6:49427169-49427191 CAGTCATGGCAGAAAGTGAAGGG - Intergenic
1009052431 6:58292514-58292536 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1009238679 6:61158100-61158122 CAGTCATGGCAGAAGGTGGAGGG - Intergenic
1010724468 6:79317573-79317595 CTGTAATCCCAGATACTTGAGGG - Intergenic
1011375766 6:86684998-86685020 CTCTCATGGTAGACAGTGGAAGG - Intergenic
1011632836 6:89344304-89344326 ATTTAATGCAAGATAGTGGATGG - Intronic
1012147516 6:95704050-95704072 CAGTCATGGCAGAAAGTGAAGGG + Intergenic
1012271065 6:97212206-97212228 CTGTCATGGCAGGTACTTGATGG + Intronic
1014415463 6:121178020-121178042 CAATCATGGCAGAAAGTGGAAGG + Intronic
1015481973 6:133722396-133722418 CTGTCATGGCAGAAAGGCGAAGG + Intergenic
1017054217 6:150423548-150423570 CTGTAATGCCATAGATTGGATGG + Intergenic
1020606527 7:10344987-10345009 CTGTTTTGCCTGATGGTGGAAGG - Intergenic
1020958024 7:14767361-14767383 ATGTCATGACAAATAGTGAATGG - Intronic
1021446002 7:20734224-20734246 CTGTCATCCTAGATTCTGGAAGG - Intronic
1023751325 7:43375768-43375790 CTGTAATCCCAGCTACTGGAGGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1026551927 7:71375952-71375974 CTGTCATCCCAGCTACTTGACGG + Intronic
1027744964 7:82061664-82061686 CAGTCATGCCAGACAGGAGATGG + Intronic
1029027727 7:97435236-97435258 CTTTCATGACAGAACGTGGAGGG - Intergenic
1029602717 7:101578557-101578579 CTGTAGTCCCAGATACTGGAAGG + Intergenic
1029972431 7:104802369-104802391 CTGTAATCCCAGATACTGGTGGG + Intronic
1030190769 7:106808116-106808138 CTGTAATCCCAGATACTTGAGGG - Intergenic
1030574498 7:111268854-111268876 CTGTAATCCCAGGTATTGGAAGG - Intronic
1032751526 7:134846378-134846400 CTGCCAGACCAGAGAGTGGAGGG + Intronic
1034276754 7:149827206-149827228 CTGTGATGCCAGGAAGTGGAAGG + Intergenic
1034961133 7:155365299-155365321 CTGCCTTCCCAGATAGTGGACGG + Intronic
1036679110 8:10857790-10857812 ATCTCATGCCAGAGGGTGGAGGG - Intergenic
1038945902 8:32359851-32359873 ATGTCATGCCAGAAAGATGAAGG + Intronic
1041187207 8:55313608-55313630 CTTTCATGCCAGCTGGTTGATGG - Intronic
1042650351 8:71033753-71033775 CACTCATGGCAGAAAGTGGAAGG - Intergenic
1042735849 8:71987716-71987738 CTGTCTTGCCAAAATGTGGAGGG + Intronic
1045975673 8:108128269-108128291 TTGTCATGGCAGTGAGTGGATGG + Intergenic
1048838267 8:138541996-138542018 CAGTCATGGCAGAGAGTGAAAGG + Intergenic
1048940215 8:139394015-139394037 CTGTCATGGCAGACAGTGTCAGG + Intergenic
1051942179 9:22521066-22521088 CTATAATCCCAGATATTGGAAGG - Intergenic
1052670793 9:31554338-31554360 CTTTCATGTCAGATACGGGATGG + Intergenic
1053523231 9:38803200-38803222 CACTCATGGCAGAAAGTGGATGG + Intergenic
1053586777 9:39466548-39466570 CAATCATGCCAGAAAGTGAAGGG - Intergenic
1054195459 9:62027619-62027641 CACTCATGGCAGAAAGTGGATGG + Intergenic
1054579530 9:66898682-66898704 CAATCATGCCAGAAAGTGAAGGG + Intronic
1054642948 9:67561070-67561092 CACTCATGGCAGAAAGTGGATGG - Intergenic
1054720479 9:68598611-68598633 CTGTGATGCCAGAGAATGTACGG - Intergenic
1056095668 9:83250729-83250751 CTGTCTTGCCAGATTGTGGCTGG + Intronic
1057330761 9:94112809-94112831 CTCACATGACAGAAAGTGGAAGG - Intergenic
1058876648 9:109250366-109250388 CTGTCCTGACTGATAGTGCATGG + Intronic
1059869003 9:118549959-118549981 CTGTCATGGGAGAAAGTAGATGG + Intergenic
1059999043 9:119941824-119941846 CTGTGATTTCACATAGTGGAAGG - Intergenic
1062652756 9:137586706-137586728 CTGTCATGCCAGCTAAAGGGAGG + Intronic
1062654336 9:137594698-137594720 CTGTCATGAAAGAAAATGGATGG + Intergenic
1185554260 X:1007997-1008019 CTGTCATCCCAGCTACTGGTGGG - Intergenic
1185589537 X:1265300-1265322 CAGTCATGACAGAAAGTGAAGGG - Intergenic
1190456071 X:50628901-50628923 CTGACATGCCAGATATAGGCAGG - Intronic
1193886466 X:86988049-86988071 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1194038719 X:88914233-88914255 CTGTCATGGCAGACAGTGAAGGG + Intergenic
1194376653 X:93142888-93142910 CAATCATGGCAGAAAGTGGAGGG - Intergenic
1197928639 X:131672955-131672977 CTGTAATCCCAGCTAGTGGGGGG + Intergenic
1199137546 X:144270889-144270911 CAGTCATGGCAGAAGGTGGAGGG + Intergenic
1201618207 Y:15925193-15925215 CTTTCATGGCAGATAGTCAATGG - Intergenic