ID: 976814931

View in Genome Browser
Species Human (GRCh38)
Location 4:89137456-89137478
Sequence TTGAATTTGAATAAAATTTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976814931_976814934 21 Left 976814931 4:89137456-89137478 CCGTAAATTTTATTCAAATTCAA No data
Right 976814934 4:89137500-89137522 AAAAGTAAATTATAAGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976814931 Original CRISPR TTGAATTTGAATAAAATTTA CGG (reversed) Intergenic
No off target data available for this crispr