ID: 976815006

View in Genome Browser
Species Human (GRCh38)
Location 4:89138048-89138070
Sequence GGACCCCGAGTGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976815006_976815013 9 Left 976815006 4:89138048-89138070 CCTTCTTCCCTCACTCGGGGTCC No data
Right 976815013 4:89138080-89138102 CATGGTCTGATGGCTCTTCCAGG No data
976815006_976815011 -1 Left 976815006 4:89138048-89138070 CCTTCTTCCCTCACTCGGGGTCC No data
Right 976815011 4:89138070-89138092 CTACCTGCTTCATGGTCTGATGG No data
976815006_976815009 -9 Left 976815006 4:89138048-89138070 CCTTCTTCCCTCACTCGGGGTCC No data
Right 976815009 4:89138062-89138084 TCGGGGTCCTACCTGCTTCATGG No data
976815006_976815014 10 Left 976815006 4:89138048-89138070 CCTTCTTCCCTCACTCGGGGTCC No data
Right 976815014 4:89138081-89138103 ATGGTCTGATGGCTCTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976815006 Original CRISPR GGACCCCGAGTGAGGGAAGA AGG (reversed) Intergenic