ID: 976815053

View in Genome Browser
Species Human (GRCh38)
Location 4:89138504-89138526
Sequence CAGGGTAAAAAGACTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976815049_976815053 10 Left 976815049 4:89138471-89138493 CCTGATACTGGAAAATTATTTCA No data
Right 976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976815053 Original CRISPR CAGGGTAAAAAGACTGAGAA AGG Intergenic
No off target data available for this crispr