ID: 976816130

View in Genome Browser
Species Human (GRCh38)
Location 4:89149671-89149693
Sequence GTGAAGACACACAGGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976816121_976816130 28 Left 976816121 4:89149620-89149642 CCTTATAAGAAGGGGAAATTTGG 0: 13
1: 176
2: 570
3: 924
4: 1365
Right 976816130 4:89149671-89149693 GTGAAGACACACAGGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976816130 Original CRISPR GTGAAGACACACAGGGAGGG TGG Intergenic
No off target data available for this crispr