ID: 976827306

View in Genome Browser
Species Human (GRCh38)
Location 4:89275077-89275099
Sequence CTTTGGCAAGCACTGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976827302_976827306 -4 Left 976827302 4:89275058-89275080 CCCAGAAGAGCTTCAGCCTCTTT 0: 1
1: 0
2: 0
3: 10
4: 256
Right 976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG No data
976827303_976827306 -5 Left 976827303 4:89275059-89275081 CCAGAAGAGCTTCAGCCTCTTTG 0: 1
1: 0
2: 0
3: 29
4: 204
Right 976827306 4:89275077-89275099 CTTTGGCAAGCACTGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976827306 Original CRISPR CTTTGGCAAGCACTGTGTTC TGG Intronic
No off target data available for this crispr