ID: 976830234

View in Genome Browser
Species Human (GRCh38)
Location 4:89307377-89307399
Sequence CTCTGGCTTTGAAGGTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 207}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976830234 Original CRISPR CTCTGGCTTTGAAGGTAAAT GGG (reversed) Intronic
900775829 1:4584885-4584907 CTCTTGTTTTGAAGGAAAACAGG + Intergenic
902696634 1:18144669-18144691 CTCTGGCTTTGAAGGGTCCTGGG - Intronic
905002214 1:34681579-34681601 CTGTTGCTCTGCAGGTAAATGGG - Intergenic
907480553 1:54743007-54743029 CACTGTCTTTGAAAGGAAATTGG + Intergenic
907971126 1:59382748-59382770 CTCTGGATTTGCAGGCCAATGGG - Intronic
908096571 1:60745686-60745708 CTCTGGCTAGGAAGGGAAACAGG + Intergenic
908116416 1:60944825-60944847 TTCTGGCTGTGAAGGAAAAATGG - Intronic
908542618 1:65136075-65136097 TTCTGGCTTTTAAGGGAAAATGG - Intergenic
909840359 1:80313326-80313348 CTCTGGCTTTGAAGATGGATGGG - Intergenic
909909267 1:81241655-81241677 CTCCTGCTTTGCAGGAAAATTGG + Intergenic
911031227 1:93490857-93490879 CTCAGGCTTTGAAACTAAAGAGG + Intronic
911877460 1:103186419-103186441 TACTAGCCTTGAAGGTAAATGGG + Intergenic
914851671 1:151318981-151319003 CTCTGGACTTGAAGGCAAATAGG + Intronic
918048660 1:180956051-180956073 CTCTGGCTTTGTAGGAAAGAGGG - Intergenic
918606114 1:186428155-186428177 CTCTAGCTATGAAAGTAGATGGG + Intergenic
920821044 1:209381162-209381184 CTCTTGCTTTGTAGTTAACTAGG - Intergenic
921172956 1:212565501-212565523 CTCTGGCTTTGGGGCTAAGTGGG + Intronic
923264857 1:232304543-232304565 ATCTTGCCTAGAAGGTAAATTGG + Intergenic
924331920 1:242948309-242948331 CACTAACATTGAAGGTAAATGGG + Intergenic
1063818639 10:9808240-9808262 CACTGGATATGATGGTAAATGGG + Intergenic
1064548328 10:16473757-16473779 CTTTGGCTTTGGAGGTATTTTGG - Intronic
1065233619 10:23624128-23624150 CTTTGGTTTCAAAGGTAAATAGG - Intergenic
1065539668 10:26750128-26750150 CTCTCTATTTGAAGGTATATGGG + Intronic
1069515176 10:69071744-69071766 CTCTGGCTTTGGAGAAGAATGGG - Intergenic
1070246716 10:74739135-74739157 TGCTGGCTTTGAAGGTGAAGGGG + Intergenic
1073638164 10:105220592-105220614 CAGTGACTTTGAAGGTAAAAGGG + Intronic
1075397604 10:122139204-122139226 CTCTCTCTGTGAAGGTAAAGTGG + Intronic
1078846626 11:15124471-15124493 CTCTGGCCTTAAGGGGAAATAGG + Intronic
1081053654 11:38380207-38380229 CTAAGACTTTGAAGGAAAATTGG + Intergenic
1081331034 11:41800448-41800470 CTCTGGATTTGAAAGGAAAGAGG + Intergenic
1081842008 11:46209348-46209370 ATCTGGCTTTGGAGATAGATTGG + Intergenic
1083550008 11:63580795-63580817 CTCTAGCTTTGAAAATAGATGGG + Intronic
1085610703 11:77945970-77945992 CTGTGGCTATGTAGGGAAATGGG - Intronic
1085852356 11:80137022-80137044 CTCAGGCTTTTAAAGTATATTGG + Intergenic
1086793072 11:91065016-91065038 CTCTGGCTTTGACAGTAAATTGG + Intergenic
1088403500 11:109446339-109446361 ATCTGGTTTTGAAGGCAAACAGG + Intergenic
1088604841 11:111518816-111518838 GTTAGGCCTTGAAGGTAAATGGG - Intronic
1090575787 11:128101918-128101940 GTTTGGATTTGAAGGTAAATTGG - Intergenic
1091829587 12:3540274-3540296 ATCTTCCTTTGAAGGCAAATAGG - Intronic
1093356530 12:18174106-18174128 CTCTGGCTTTTAAGGGAATAGGG - Intronic
1095667881 12:44823835-44823857 CTGTTGGTTTGAACGTAAATTGG - Intronic
1098595405 12:72269124-72269146 CTTTTGCTTTGAAGGTAGAATGG + Intronic
1103832991 12:123795485-123795507 CACTGGCTTTGAAGATGAAAGGG - Intronic
1104249280 12:127075567-127075589 GTCTGGCTTTGAAGGTGGACAGG + Intergenic
1106440493 13:29762693-29762715 CTCTGGAATAGAAGGAAAATAGG - Intergenic
1106505674 13:30368750-30368772 CACTGGCTTTGCAGGCGAATGGG - Intergenic
1109324135 13:60847395-60847417 TTCTGGCTTTGAAGATGGATTGG - Intergenic
1109332994 13:60954249-60954271 CTATGGCTTTCAAAGTTAATAGG - Intergenic
1111657731 13:91174454-91174476 CTCTGTCTATAAAGATAAATTGG + Intergenic
1113486593 13:110657360-110657382 CCCTGCCTTTGAGGGGAAATGGG - Intronic
1115100967 14:29699259-29699281 CTGTTGGTTGGAAGGTAAATTGG - Intronic
1116663524 14:47744520-47744542 TTCTGGCTAAGGAGGTAAATTGG + Intergenic
1117183401 14:53215621-53215643 CTCTAGCTTTGGAGGAAAGTGGG - Intergenic
1117410189 14:55443393-55443415 TGCTGGCTTTGAAGATAAATGGG + Intronic
1118494147 14:66291510-66291532 CTCTGGCTATTAAGGGAAAGGGG + Intergenic
1121594892 14:95154683-95154705 CTCTGGCATTGAAGGTAGGATGG + Intronic
1124783573 15:32658682-32658704 CTCTGTCCTTGCAGATAAATAGG + Intronic
1130107922 15:80942931-80942953 CTCTGGCTCTGTAGGTGGATGGG + Exonic
1131823995 15:96302359-96302381 CTCTGGCTGTTAAGGTACAGTGG - Intergenic
1133307189 16:4817831-4817853 CCCTGGCTCTGCAGGTAGATTGG - Intronic
1137881295 16:52051171-52051193 CTCTGGTTTTGAAGGAAAACTGG - Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1139017113 16:62703770-62703792 TGCTGGCTTTGAGGGTAAAGTGG + Intergenic
1139085711 16:63583190-63583212 CTCTGAATTTGAAAGAAAATGGG - Intergenic
1140705611 16:77626016-77626038 CTCTGGCCTTGAAGATTTATGGG + Intergenic
1141349014 16:83275653-83275675 CTCTGGCTTGGAAGATAAGGGGG + Intronic
1141622547 16:85244287-85244309 CGCTGGCTTTGAAGGTGGAAGGG + Intergenic
1144278582 17:13701043-13701065 CTTTGGCTTTGAAGATTAAATGG + Intergenic
1145886816 17:28387816-28387838 GTCTGGCTTTGGTGGGAAATAGG + Intronic
1151749883 17:76030857-76030879 CTCTGGCCTGGAAGTTAGATAGG + Intergenic
1155186393 18:23390538-23390560 CTCTGGCTATAAAGAGAAATTGG + Intronic
1157669474 18:49516128-49516150 CTCTGGCCTTGAAGATACATAGG - Intergenic
1157804198 18:50645942-50645964 GTCTAGTTTGGAAGGTAAATGGG + Intronic
1158226474 18:55206493-55206515 GTGTGGCTTTGAAGGTATATTGG + Intergenic
1158464878 18:57681182-57681204 CGCTGGCTTTGAAGGTGAAGTGG + Intronic
1160458473 18:79019501-79019523 ATCTGGGTTTGGGGGTAAATGGG - Intergenic
1160596236 18:79976388-79976410 TGCTGGCTTTGAGGGTAACTGGG + Intronic
1162199573 19:9010659-9010681 CTCTGGGCTTGAAGGAAAACAGG + Intergenic
1164505630 19:28858643-28858665 CTCTGCTCTTGAAGGTAAAGTGG - Intergenic
1164510744 19:28895045-28895067 CTCTGGATAAGAAGGTAATTGGG - Intergenic
1165275339 19:34746198-34746220 CTCTGGCATCAAAGATAAATAGG + Intergenic
1167137145 19:47623630-47623652 ATCTGGCTTTGCAGGGGAATGGG - Intronic
1167497413 19:49827758-49827780 CTCTGGCTGGGAAGGTGAAGTGG + Intronic
1168092346 19:54094495-54094517 CTCTTGCCTTGACGGTAAAATGG - Intergenic
926665069 2:15512661-15512683 CGCTGGCTTTGAAGGTAGAAGGG + Intronic
927957608 2:27218570-27218592 CACTGGTTTTGTAGGTAAACTGG - Intronic
928950278 2:36807802-36807824 GTCTGGTTCTGAAGGTGAATAGG + Intronic
930485943 2:52011282-52011304 TTGTGGCTTTGAAGGTATCTTGG + Intergenic
930731946 2:54736307-54736329 GTCTGGCATTGAAGGAAAAGAGG - Intronic
931222946 2:60304645-60304667 CTCTGGCCTTGATGTAAAATGGG + Intergenic
932160445 2:69455011-69455033 ACCTGGCTTTGGAGGTAAAAGGG - Intergenic
932327693 2:70873941-70873963 ACCTGGCTCAGAAGGTAAATGGG - Intergenic
932764461 2:74461215-74461237 CTCTGGCTCTGAAGGGACAAAGG - Exonic
932837149 2:75048441-75048463 CTCAGGATTTTAAGATAAATCGG + Exonic
933027570 2:77280183-77280205 GGCTGGCTTTGGAGGTAAAATGG + Intronic
933280408 2:80326761-80326783 CTCTAGCTTTAAAGGAAGATGGG + Intronic
935360794 2:102244918-102244940 CTTTGGCTTGGAAGGTAGACAGG - Intergenic
936901295 2:117484794-117484816 CTCGGGCTTTGAATGAACATTGG - Intergenic
939812107 2:146846236-146846258 CTCTGAATTTGAAGATATATGGG + Intergenic
939910347 2:147974931-147974953 ATCTGGCATAGAAGTTAAATAGG + Intronic
941272033 2:163442109-163442131 CTCTAGCTGCGAAGATAAATTGG + Intergenic
943169698 2:184382396-184382418 ATCTGGCTTTGAAGATAGAGGGG + Intergenic
943743050 2:191431823-191431845 CTGTGGCTTTGAATTTAAATGGG + Intergenic
944747338 2:202671595-202671617 CACTGGCTGTGAATGGAAATGGG + Intronic
945956395 2:216090208-216090230 CTCTGAGTTTGAAGGCAAAGGGG + Intronic
946259625 2:218476025-218476047 CTCTGGCTTTAAAGTAAGATAGG + Intronic
947883445 2:233542812-233542834 CTCTGGCTTTAGTTGTAAATTGG + Intronic
1170873995 20:20233921-20233943 CTTTGGCATTAAAGGTAAGTAGG + Intronic
1171079482 20:22163929-22163951 CTTTGGTTTGGAAAGTAAATAGG + Intergenic
1171422370 20:25025759-25025781 TGCTGGCTTTGAAGATAAACAGG - Intronic
1173835546 20:46122941-46122963 ATCTGCCTTTGAAGGGCAATGGG + Intronic
1175461804 20:59157416-59157438 CTCTGGCTTGGGAGGCGAATTGG + Intergenic
1176080455 20:63270028-63270050 CTCTGGCTTGAAAGGGAAATTGG + Intronic
1176666514 21:9692595-9692617 CTCTTGTTTTGAAAGCAAATTGG + Intergenic
1177591356 21:23172235-23172257 TTCTGCCTTTGAAGGAAAGTTGG + Intergenic
1177714303 21:24819135-24819157 CTCTGACTTTGAAGACAGATGGG + Intergenic
1177761930 21:25411962-25411984 CTCTGGCTTTAATACTAAATTGG - Intergenic
1177902760 21:26936624-26936646 TTCTGGCTCAGAAGTTAAATAGG - Intronic
1178663112 21:34523039-34523061 GTCTGGCTTGAAAGGAAAATAGG - Intronic
1179159208 21:38878119-38878141 CTCTGGCTTTGGAGGTCATATGG + Intergenic
1183007968 22:34919028-34919050 CTCTGGCTTTGATAGGAAAGGGG - Intergenic
949226043 3:1697578-1697600 CTCTGGATATGAAGGGAAAGAGG + Intergenic
949817145 3:8070434-8070456 TTCTGGCTTTGAAGGAAAACAGG + Intergenic
952404712 3:32995038-32995060 CTCTGGCTTTGGAGGGAGGTAGG + Intergenic
958425374 3:93973374-93973396 CTTCAGCTTTGAAGGGAAATGGG + Intronic
958914333 3:100031672-100031694 CTCAGCCTTAGAAGGAAAATTGG - Intronic
959980216 3:112507697-112507719 TGCTGGCTTTGAAGATAAAGGGG - Intergenic
961027451 3:123571491-123571513 CTCTGGCTTTGAAGCTGCAGGGG + Intronic
962366377 3:134787732-134787754 CTCTTGGTTGGAAGGTAAATTGG + Intronic
964934586 3:162066680-162066702 TTCTAAATTTGAAGGTAAATGGG + Intergenic
965206408 3:165723041-165723063 ATTTGGCTATGAATGTAAATAGG + Intergenic
966653476 3:182327119-182327141 CCTTGGCTTGGAAGGTTAATTGG + Intergenic
966937753 3:184724854-184724876 CTCAGGCCTTGACTGTAAATAGG + Intergenic
967479585 3:189958380-189958402 GTCGGGCTTTTAAGGCAAATAGG - Intronic
969852930 4:9976379-9976401 CTCAGTCTTTGAAGGTAAATGGG + Intronic
971567984 4:28169254-28169276 ATATGCATTTGAAGGTAAATTGG + Intergenic
971953122 4:33380219-33380241 CACTGGCTTTGAACATAAAAGGG + Intergenic
973173695 4:47177223-47177245 CTGTGGCTTTGAAGATAAAAAGG - Intronic
973225381 4:47777949-47777971 CTCTGGTTCTGAAAGAAAATTGG - Intronic
974993717 4:69126958-69126980 AACTTACTTTGAAGGTAAATGGG - Intronic
975904835 4:79196887-79196909 CACTGGCTTTGAAGATAGAAGGG + Intergenic
976830234 4:89307377-89307399 CTCTGGCTTTGAAGGTAAATGGG - Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978732650 4:112048210-112048232 CTCTGGCTAATAAGGTAAAGTGG + Intergenic
981759047 4:148173454-148173476 ATCTGGCTTTGAAGATAGAAGGG + Intronic
982198918 4:152940711-152940733 ATCTGGAATTGGAGGTAAATTGG + Intronic
982313563 4:154009577-154009599 CTCTGGCTCTGGAGGTGACTGGG + Intergenic
982717531 4:158824637-158824659 ATCTGGCTGTTAAGGAAAATGGG - Intronic
983493201 4:168412660-168412682 CTCAGGCCTTGAATGAAAATTGG + Intronic
986663603 5:10080816-10080838 CTCTGGTTATGAATGTGAATTGG - Intergenic
990961443 5:61397920-61397942 CTTTTGTTTTGAAGGTAAAGTGG - Intronic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
995964558 5:117888911-117888933 CTCTTGCTCTGAAGATAAAAGGG - Intergenic
997185682 5:131879666-131879688 CTTTGGATTTGGAAGTAAATAGG - Intronic
997520792 5:134524017-134524039 CTTTGGCTTTGAAGGCACGTGGG - Intergenic
997986319 5:138504252-138504274 CTCTGGCTCTGCAGTTAACTGGG - Intergenic
998661969 5:144248704-144248726 CTCTGGCTTTGCTGATGAATTGG + Intronic
999512145 5:152263345-152263367 CTCTGGCCTTCATGGTAAAATGG - Intergenic
1000248190 5:159467872-159467894 CTTTGCCTTTGTAGGTGAATTGG - Intergenic
1001003838 5:168031994-168032016 GTCTGGCTTTGGAGGGAAGTAGG + Intronic
1001071802 5:168592118-168592140 CAGTGGCTGTGAAGGTAAACAGG - Intergenic
1001879440 5:175230681-175230703 CTCTTGATTTGAAGGGAAAATGG - Intergenic
1004094705 6:12541376-12541398 ATCTGTCTTTGAAGGTAAGAAGG - Intergenic
1004443109 6:15672309-15672331 CCCTGGCTCTGAATGTAAAGAGG + Intergenic
1005098331 6:22142886-22142908 CTCTGGCTCTGGAAGTAAAAAGG - Intergenic
1005330234 6:24742630-24742652 TTGTAGCGTTGAAGGTAAATGGG + Intergenic
1008195805 6:48518746-48518768 CTCTAGTTTTAAATGTAAATAGG + Intergenic
1008862177 6:56162115-56162137 TTCTGGCTTTGAAAGTTGATAGG - Intronic
1009165357 6:60334653-60334675 TTCTGGATTAGAAGGAAAATTGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1011431197 6:87288751-87288773 CTTTGGCCTTGAATGTAGATTGG - Intronic
1013905405 6:115211161-115211183 CTCTTGCTTTGAAGATTAATGGG + Intergenic
1014511999 6:122333869-122333891 CTCTCGCTCTTAAGGTAATTTGG + Intergenic
1014540346 6:122668366-122668388 CTCTTCCTTTGAAGAGAAATCGG - Intronic
1015191081 6:130473048-130473070 TGCTGGCTTTGAAGATAAGTGGG + Intergenic
1015928742 6:138335309-138335331 CTCTGACTTTGGAGGGAAATCGG - Intronic
1016059457 6:139614659-139614681 CTATGGCTTTGGAGGTTACTGGG - Intergenic
1016429831 6:143971524-143971546 CTCTGGCTTTAAAAAGAAATAGG + Intronic
1017408426 6:154144302-154144324 CAGTAGCTTTGAAAGTAAATTGG - Intronic
1017442951 6:154480748-154480770 ATCTGGCTTTCAAGGAAACTGGG - Intronic
1018311497 6:162514328-162514350 ATCTGTCTTTGAAAATAAATTGG - Intronic
1018343248 6:162874511-162874533 ATCTGGCTTTGAAGCTGACTAGG - Intronic
1019127646 6:169851697-169851719 CACGGGCTTTGAAGACAAATGGG - Intergenic
1020466951 7:8490948-8490970 CTGTGTCTATGAATGTAAATAGG + Intronic
1021352650 7:19613930-19613952 CTGAGGCTTTGAAGGTGACTAGG - Intergenic
1021444634 7:20719205-20719227 TTCTGTCTTTCCAGGTAAATAGG + Intronic
1024094037 7:45970205-45970227 GCCTGGCCTTGAAGGTAACTAGG + Intergenic
1026662172 7:72311860-72311882 CTCAGACTTTGAAGAAAAATAGG + Intronic
1031550983 7:123111243-123111265 TGCTGGCTTTGAAGATAAAAGGG - Intergenic
1031656147 7:124358566-124358588 CTCTGGCCTTTAGGGGAAATTGG - Intergenic
1033680560 7:143590780-143590802 CTGTGGTTTTGAAGTAAAATTGG - Intergenic
1033704334 7:143871032-143871054 CTGTGGTTTTGAAGTAAAATTGG + Intronic
1036034796 8:5007363-5007385 ATGTGGCTTTCAGGGTAAATAGG - Intergenic
1037040419 8:14224410-14224432 CTCTAGCTCTGAAGGTGAAAGGG + Intronic
1042380804 8:68112106-68112128 CTTTGGCTCTGAAGCTAAGTAGG - Intronic
1043447613 8:80334561-80334583 CCCTGCCTTTTAAGGAAAATGGG - Intergenic
1044560702 8:93609185-93609207 CGCTGGCTTTGAAGATGAAGGGG - Intergenic
1046364914 8:113215105-113215127 TTATGGCTTTAAAGATAAATAGG + Intronic
1046887494 8:119383639-119383661 TGCTGGCTTTGAAGATGAATAGG + Intergenic
1048134282 8:131731920-131731942 CTCTGTCTTTGTATTTAAATTGG - Intergenic
1050584239 9:7093819-7093841 CTCTGGATCTGAAGGTAGAGGGG + Intergenic
1051176303 9:14364156-14364178 CTGTGGCTGTGAGTGTAAATGGG - Intronic
1052017079 9:23481761-23481783 GTCTGGCTTTGAAGGTGGAAAGG - Intergenic
1052129252 9:24821782-24821804 CTCTGGCTCTGTAGGAAACTGGG - Intergenic
1052573035 9:30253588-30253610 CTCTGGCTTTGAAGACAGAAGGG - Intergenic
1052705244 9:31987476-31987498 CTTTTTCTTTGAAGGAAAATTGG - Intergenic
1055178457 9:73351347-73351369 CTGTGGGTAGGAAGGTAAATTGG - Intergenic
1056314888 9:85378567-85378589 CTCTGACTTAGTAGGCAAATGGG + Intergenic
1057067230 9:92066705-92066727 CTCTGGCTGTGATGTTAAAAAGG + Intronic
1057340697 9:94198653-94198675 CTCTTGCTTTGCAGGTAGATTGG - Intergenic
1058159000 9:101547059-101547081 CTCATCCTTTGAAGGTACATTGG + Intronic
1061357380 9:130116692-130116714 CTCTAGAATCGAAGGTAAATAGG + Intronic
1203659587 Un_KI270753v1:29166-29188 CTCTTGTTTTGAAAGCAAATTGG - Intergenic
1186342438 X:8658739-8658761 CTCTCACTTTGCAGGTAAAGAGG + Intronic
1187606540 X:20890879-20890901 CTCTGCTTTTGAAGGTCAGTTGG + Intergenic
1189238099 X:39504071-39504093 TTCTGGCTTTGCAGGTAAGTAGG - Intergenic
1191032987 X:55995374-55995396 CACTAACTTTGAATGTAAATGGG - Intergenic
1191827004 X:65376408-65376430 CTCTGGCCTTGAGTGAAAATAGG + Intronic
1192115022 X:68401861-68401883 CTTTGGCTATCAAGCTAAATTGG - Intronic
1193890515 X:87039920-87039942 TTCTGGCTCTGAAGCTAAATTGG + Intergenic
1193998167 X:88392224-88392246 TTCTGGGTTTGAAGGGTAATTGG + Intergenic
1194817110 X:98456121-98456143 CTTTTCCTTTGAAGGTAGATGGG + Intergenic
1195532545 X:105973136-105973158 CTCAGGCCGTGAAGGTAAACGGG + Intergenic
1195777726 X:108426284-108426306 CTCTGGCTCTGAGGCTGAATTGG - Intronic
1197301274 X:124784294-124784316 CTCAGGATATGAAGGAAAATAGG + Intronic
1198393174 X:136196822-136196844 CTCTGGCTCTGGAGCTAATTTGG + Intronic
1199209596 X:145192150-145192172 TTCTGGCTGGGAAGGAAAATGGG - Intergenic
1199691023 X:150309069-150309091 CTCTGGCATTGCAGGTACAGAGG + Intergenic
1201229260 Y:11847475-11847497 CACTAACCTTGAAGGTAAATGGG + Intergenic