ID: 976831583

View in Genome Browser
Species Human (GRCh38)
Location 4:89320938-89320960
Sequence CTGCACAAATAGATGCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976831580_976831583 -10 Left 976831580 4:89320925-89320947 CCTTTAGAAGCCTCTGCACAAAT No data
Right 976831583 4:89320938-89320960 CTGCACAAATAGATGCTTCAGGG No data
976831579_976831583 -4 Left 976831579 4:89320919-89320941 CCTGCACCTTTAGAAGCCTCTGC No data
Right 976831583 4:89320938-89320960 CTGCACAAATAGATGCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976831583 Original CRISPR CTGCACAAATAGATGCTTCA GGG Intergenic
No off target data available for this crispr