ID: 976834690

View in Genome Browser
Species Human (GRCh38)
Location 4:89357805-89357827
Sequence GAGAGTGAACTGATGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976834690_976834692 11 Left 976834690 4:89357805-89357827 CCTTTCTCCATCAGTTCACTCTC No data
Right 976834692 4:89357839-89357861 CTTTCTGTTCTCCTGTGCTGAGG No data
976834690_976834694 24 Left 976834690 4:89357805-89357827 CCTTTCTCCATCAGTTCACTCTC No data
Right 976834694 4:89357852-89357874 TGTGCTGAGGACACATTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976834690 Original CRISPR GAGAGTGAACTGATGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr