ID: 976834690 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:89357805-89357827 |
| Sequence | GAGAGTGAACTGATGGAGAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 976834690_976834692 | 11 | Left | 976834690 | 4:89357805-89357827 | CCTTTCTCCATCAGTTCACTCTC | No data | ||
| Right | 976834692 | 4:89357839-89357861 | CTTTCTGTTCTCCTGTGCTGAGG | No data | ||||
| 976834690_976834694 | 24 | Left | 976834690 | 4:89357805-89357827 | CCTTTCTCCATCAGTTCACTCTC | No data | ||
| Right | 976834694 | 4:89357852-89357874 | TGTGCTGAGGACACATTTCACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 976834690 | Original CRISPR | GAGAGTGAACTGATGGAGAA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||