ID: 976837418

View in Genome Browser
Species Human (GRCh38)
Location 4:89390958-89390980
Sequence TCTGATGGGCTTCCCTTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837418_976837422 -4 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837422 4:89390977-89390999 CAGACTAGCAGCTGATCTATCGG No data
976837418_976837424 25 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837424 4:89391006-89391028 CTCTACAAGGCAGAAGAGAGTGG No data
976837418_976837427 28 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837427 4:89391009-89391031 TACAAGGCAGAAGAGAGTGGGGG No data
976837418_976837425 26 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837425 4:89391007-89391029 TCTACAAGGCAGAAGAGAGTGGG No data
976837418_976837426 27 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837426 4:89391008-89391030 CTACAAGGCAGAAGAGAGTGGGG No data
976837418_976837423 12 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA No data
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837418 Original CRISPR TCTGATGGGCTTCCCTTTGC GGG (reversed) Intergenic