ID: 976837419

View in Genome Browser
Species Human (GRCh38)
Location 4:89390959-89390981
Sequence GTCTGATGGGCTTCCCTTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837419_976837426 26 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837426 4:89391008-89391030 CTACAAGGCAGAAGAGAGTGGGG No data
976837419_976837422 -5 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837422 4:89390977-89390999 CAGACTAGCAGCTGATCTATCGG No data
976837419_976837425 25 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837425 4:89391007-89391029 TCTACAAGGCAGAAGAGAGTGGG No data
976837419_976837423 11 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data
976837419_976837427 27 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837427 4:89391009-89391031 TACAAGGCAGAAGAGAGTGGGGG No data
976837419_976837424 24 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC No data
Right 976837424 4:89391006-89391028 CTCTACAAGGCAGAAGAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837419 Original CRISPR GTCTGATGGGCTTCCCTTTG CGG (reversed) Intergenic