ID: 976837421

View in Genome Browser
Species Human (GRCh38)
Location 4:89390973-89390995
Sequence TAGATCAGCTGCTAGTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837421_976837424 10 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837424 4:89391006-89391028 CTCTACAAGGCAGAAGAGAGTGG No data
976837421_976837423 -3 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data
976837421_976837426 12 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837426 4:89391008-89391030 CTACAAGGCAGAAGAGAGTGGGG No data
976837421_976837425 11 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837425 4:89391007-89391029 TCTACAAGGCAGAAGAGAGTGGG No data
976837421_976837427 13 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837427 4:89391009-89391031 TACAAGGCAGAAGAGAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837421 Original CRISPR TAGATCAGCTGCTAGTCTGA TGG (reversed) Intergenic