ID: 976837423

View in Genome Browser
Species Human (GRCh38)
Location 4:89390993-89391015
Sequence CTATCGGCAGAAACTCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837421_976837423 -3 Left 976837421 4:89390973-89390995 CCATCAGACTAGCAGCTGATCTA No data
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data
976837418_976837423 12 Left 976837418 4:89390958-89390980 CCCGCAAAGGGAAGCCCATCAGA 0: 71
1: 6462
2: 3391
3: 1356
4: 986
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data
976837420_976837423 -2 Left 976837420 4:89390972-89390994 CCCATCAGACTAGCAGCTGATCT 0: 7
1: 1354
2: 4704
3: 3138
4: 2488
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data
976837419_976837423 11 Left 976837419 4:89390959-89390981 CCGCAAAGGGAAGCCCATCAGAC 0: 5864
1: 2938
2: 903
3: 329
4: 257
Right 976837423 4:89390993-89391015 CTATCGGCAGAAACTCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837423 Original CRISPR CTATCGGCAGAAACTCTACA AGG Intergenic
No off target data available for this crispr