ID: 976837868

View in Genome Browser
Species Human (GRCh38)
Location 4:89396347-89396369
Sequence AAGGATCTTGCCTCAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837868_976837873 13 Left 976837868 4:89396347-89396369 CCCACTACTGAGGCAAGATCCTT No data
Right 976837873 4:89396383-89396405 CTTATACCCATGAATTGTGAGGG No data
976837868_976837876 26 Left 976837868 4:89396347-89396369 CCCACTACTGAGGCAAGATCCTT No data
Right 976837876 4:89396396-89396418 ATTGTGAGGGTTTTCCTCTCTGG No data
976837868_976837872 12 Left 976837868 4:89396347-89396369 CCCACTACTGAGGCAAGATCCTT No data
Right 976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG No data
976837868_976837877 30 Left 976837868 4:89396347-89396369 CCCACTACTGAGGCAAGATCCTT No data
Right 976837877 4:89396400-89396422 TGAGGGTTTTCCTCTCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837868 Original CRISPR AAGGATCTTGCCTCAGTAGT GGG (reversed) Intergenic
No off target data available for this crispr