ID: 976837870

View in Genome Browser
Species Human (GRCh38)
Location 4:89396366-89396388
Sequence TATAAGGTAGAATACTCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837870_976837872 -7 Left 976837870 4:89396366-89396388 CCTTCTGAGTATTCTACCTTATA No data
Right 976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG No data
976837870_976837877 11 Left 976837870 4:89396366-89396388 CCTTCTGAGTATTCTACCTTATA No data
Right 976837877 4:89396400-89396422 TGAGGGTTTTCCTCTCTGGCAGG No data
976837870_976837873 -6 Left 976837870 4:89396366-89396388 CCTTCTGAGTATTCTACCTTATA No data
Right 976837873 4:89396383-89396405 CTTATACCCATGAATTGTGAGGG No data
976837870_976837876 7 Left 976837870 4:89396366-89396388 CCTTCTGAGTATTCTACCTTATA No data
Right 976837876 4:89396396-89396418 ATTGTGAGGGTTTTCCTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837870 Original CRISPR TATAAGGTAGAATACTCAGA AGG (reversed) Intergenic
No off target data available for this crispr