ID: 976837872

View in Genome Browser
Species Human (GRCh38)
Location 4:89396382-89396404
Sequence CCTTATACCCATGAATTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976837870_976837872 -7 Left 976837870 4:89396366-89396388 CCTTCTGAGTATTCTACCTTATA No data
Right 976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG No data
976837869_976837872 11 Left 976837869 4:89396348-89396370 CCACTACTGAGGCAAGATCCTTC No data
Right 976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG No data
976837868_976837872 12 Left 976837868 4:89396347-89396369 CCCACTACTGAGGCAAGATCCTT No data
Right 976837872 4:89396382-89396404 CCTTATACCCATGAATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976837872 Original CRISPR CCTTATACCCATGAATTGTG AGG Intergenic
No off target data available for this crispr