ID: 976839597

View in Genome Browser
Species Human (GRCh38)
Location 4:89416383-89416405
Sequence GCCTCATGAAAGACTCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976839597_976839604 21 Left 976839597 4:89416383-89416405 CCTACATGAGTCTTTCATGAGGC No data
Right 976839604 4:89416427-89416449 TTTCTGGCCAGCCTTATTTTGGG No data
976839597_976839600 5 Left 976839597 4:89416383-89416405 CCTACATGAGTCTTTCATGAGGC No data
Right 976839600 4:89416411-89416433 TTGGAAAGCCCAGTTCTTTCTGG No data
976839597_976839603 20 Left 976839597 4:89416383-89416405 CCTACATGAGTCTTTCATGAGGC No data
Right 976839603 4:89416426-89416448 CTTTCTGGCCAGCCTTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976839597 Original CRISPR GCCTCATGAAAGACTCATGT AGG (reversed) Intergenic
No off target data available for this crispr