ID: 976841120

View in Genome Browser
Species Human (GRCh38)
Location 4:89433338-89433360
Sequence GTGGCTAAAGGTCTGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
976841110_976841120 8 Left 976841110 4:89433307-89433329 CCAGCGAGCAGGGACAAGTGGGA No data
Right 976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG No data
976841106_976841120 18 Left 976841106 4:89433297-89433319 CCACAGTAATCCAGCGAGCAGGG No data
Right 976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
976841120 Original CRISPR GTGGCTAAAGGTCTGGGGGA AGG Intergenic
No off target data available for this crispr